Manes.01G005500.1.v6.1 (mRNA)

Overview
NameManes.01G005500.1
Unique NameManes.01G005500.1.v6.1
TypemRNA
OrganismManihot esculenta (Cassava)
Sequence length13512
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chromosome01chromosomeChromosome01:956640..970151 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Manihot esculenta (JGI)2015-07-22
Properties
Property NameValue
Pacid32357335
Longest1
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
Manes.01G005500Manes.01G005500.v6.1Manihot esculentagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G005500.1Manes.01G005500.1.v6.1-proteinManihot esculentapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G005500.1.v6.1.CDS.33Manes.01G005500.1.v6.1.CDS.33Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.32Manes.01G005500.1.v6.1.CDS.32Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.31Manes.01G005500.1.v6.1.CDS.31Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.30Manes.01G005500.1.v6.1.CDS.30Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.29Manes.01G005500.1.v6.1.CDS.29Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.28Manes.01G005500.1.v6.1.CDS.28Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.27Manes.01G005500.1.v6.1.CDS.27Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.26Manes.01G005500.1.v6.1.CDS.26Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.25Manes.01G005500.1.v6.1.CDS.25Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.24Manes.01G005500.1.v6.1.CDS.24Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.23Manes.01G005500.1.v6.1.CDS.23Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.22Manes.01G005500.1.v6.1.CDS.22Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.21Manes.01G005500.1.v6.1.CDS.21Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.20Manes.01G005500.1.v6.1.CDS.20Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.19Manes.01G005500.1.v6.1.CDS.19Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.18Manes.01G005500.1.v6.1.CDS.18Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.17Manes.01G005500.1.v6.1.CDS.17Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.16Manes.01G005500.1.v6.1.CDS.16Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.15Manes.01G005500.1.v6.1.CDS.15Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.14Manes.01G005500.1.v6.1.CDS.14Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.13Manes.01G005500.1.v6.1.CDS.13Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.12Manes.01G005500.1.v6.1.CDS.12Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.11Manes.01G005500.1.v6.1.CDS.11Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.10Manes.01G005500.1.v6.1.CDS.10Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.9Manes.01G005500.1.v6.1.CDS.9Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.8Manes.01G005500.1.v6.1.CDS.8Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.7Manes.01G005500.1.v6.1.CDS.7Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.6Manes.01G005500.1.v6.1.CDS.6Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.5Manes.01G005500.1.v6.1.CDS.5Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.4Manes.01G005500.1.v6.1.CDS.4Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.3Manes.01G005500.1.v6.1.CDS.3Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.2Manes.01G005500.1.v6.1.CDS.2Manihot esculentaCDS
Manes.01G005500.1.v6.1.CDS.1Manes.01G005500.1.v6.1.CDS.1Manihot esculentaCDS


The following five_prime_UTR feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G005500.1.v6.1.five_prime_UTR.1Manes.01G005500.1.v6.1.five_prime_UTR.1Manihot esculentafive_prime_UTR


Sequences
The following sequences are available for this feature:

mRNA sequence

>Manes.01G005500.1.v6.1 ID=Manes.01G005500.1.v6.1|Name=Manes.01G005500.1|organism=Manihot esculenta|type=mRNA|length=13512bp
CTAAACATACCCGGGCATATCATATGGGACGGATAATACAGAAGCAGCCA
AAGCAAGCACAGCACCATGAATAGATGCTATTGATTGTCCAGATTTTGAA
TTCCTGCATTCATACATAAAACTTATGGATCAAAATATAGAGCATGAAAT
CCCAAACCAACAATGGTTATGCAATTACTAAAAGCATGTTAAAAGAAAAA
ATGTGGAATAAATCCTATGCACATATCATGAAAATGAGAATCACAAAAGC
ACATTATATTAGTGACTTTCAGCCATGGAAAAGAAAATTTAAAAGTAACT
TTTATGCATAATCCGTTCCAGACATGTAGGCCCCATATAAAGAGTACAAG
ACCATATTGTTGTAACCATGATGAGAAGGTAAATAACTAAATTTAACTAA
CAAAGGGTACTAGATAGACCACTAACCTCATCTTTCTCTTCCTTTGAATG
GTACTGGCCACTATGAAAGCTCTATCACGGAAGTCTTTAGCAAGATCTTC
ATCCCCGCCCTTCATTAGACCTGCTAGAACTGCCGCAGCATGCTCTCTCA
CCTAAGCAAGGTATCAACTATTTAGAAAAGGGACTAGAAGAAAATATATC
TCTAACTCTAGTCAAGGACTTCTCCATCACAGAAATCTCAAACTTCTTTA
TCACATGTGCGAGTCATTGAGATCAACATTTATTATCAAACTATTGATAA
GGACAAGGATTATTCTTCATCCACATCTACATCTTCTAATCTACACTACT
CTTCAATTCAAGATTCAACCAGCAACTTGCCTCTACTTGATTGTCCCTCA
GTAAATTCTCAACAGTACTCCAAATTTGTTGTTTCTCAATCCTCGAGAGA
ATAGAAGTATGCCTGTTACAAGAGGGAGAAAAAAAAAGGTACACAAATTC
ATTAGACCCTGCATCATAACATAGACCGTCTTTTTGACAGGCTACAAATT
AGTCAACCAGCCTGATATCCCATCTATGAAATGGGCATCAAAAGGGTGAA
TTGGGACCAGTCAGTTAATTGCCACTCTGTAGCAGATGGTATTAAGCATA
GTCTCACATGATAACATGGAAACTGAAATTTTTCTGTTCGCAAGAATTTA
GAGAACCAAATACAGCACATTAAAATATTGACATACTGTAAGAATTACTT
AAATAGAGAACCAGAATCTCCAATTTAGCCTCGCACATATGAACAATCTG
ATGCATAAACAGAACTTTTTGAATAAGTATTATACCTATACATGAAAGTA
CGTAGATATGTCAGAGTAGCTGATCTGGTCCGCCAGTTAGGATCATTGGC
TGAAGTAAGGATAACTGAAACAACACTTTGAAGATGAGGTTCCCAGAAAA
TCCTCCATTTTAGCAATTCGAAAGCAGCCTTGGCCAGGGTTGATAAGTCT
TTATTTGATGTTTCCTTCAACAGGTCAATAGTATTTATCAGATACAGTTT
CTACATGAAATTGTTTAAAGCAATTGCAATATATTCCATAACAACAATAT
TCAATTTGGCATGGAGGTGAAGAGTTTAGCTTTGAGGAGTGCCATGTCAT
TAGCATCCAAAAAAGACTGCTTATTTTGAAGTGTAAAATCTGAGAAACGA
GCTTTTATACTGGTGTCTGATTTGAACATGGCAACAGAGTAAATATATTT
AAGATGAACACAAAAGTTCTCAATTTGCAAATTTGCATCAAATAATATAT
GTATTGGTACTGCAGTCACCACCTAAAGGGAATGATAAATATTCTCAAGC
CATACTAGCAGAAAAATATAACTCACGCACCTGCAAGGAAATTACTGGAT
AGAGAAACTGCACAATGACATCCAGCAAATAAGATGATCTTCCAGATTTC
AGTGTTGATATGACAAAATGAAAGAGCTACAGCAAAACAAAACAAAACAA
AAAAAAAGTTAAAATTAAAATGAAAATAAATAAATACATCAAGTTAAAAA
AAATCTAATTGCTTTAAAAATTAGTACCGTTTCCATCCACTTAACATCAT
CCTGTGCATCTCCATTCAAGGACCCATTTTGAGGAACTGTCCGTGTTGGT
ATCTCTAAATTGTCCAAAGGGCTAGTTTTCTGAATATTTGTGACCACATC
AGAAGCTCGTTCTGTCAGAAACAGAACCCAATTTTCCTCTTTTAGTAGTT
TATCAAAGTCAGCATTTGCATCTTCACTTGAATGATTATGAGCAATTGAT
AAATGAAGGCGAATATTGGAGCACAATATGGACAGGGTGACCCCTATAGC
TTCCCTTACCTGCCCCATGGGAAAATTCACATCAAAATATAACCATAAAA
TAACTTCAACTTATAAAAATTATGGTTGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCTAGATTCTCAGCTGAC
AACTTATATGGCGATTCTTTTAGAAGAGTATTCAGAGCTGAGATTGCAAG
TATTCTTGTCTGAGGAAGTTGACTCTTTAAACTTTTTAGGAAGTGACCTG
AAAGGTAGGAAACGACATTGTTGATAATGCTACTCCCTTTTCATTAACAG
AGAAAGTGCTGGTAAGAAAAACAGTGGCAATCCATAAGCCAACAAGAAAA
TTGCTAACCAGCAGTTTCACTCAGTATTTTTGAAGAGAAGCTTGGCTCAT
TTCTAGATGTCATGGCCAACAAAAGCAGAACCCTATTAGCCATCAGGTTA
TACCTTACAAGAGAGAGAAAAAAAAAGGCATGAAATTGAGCCAATATCCA
AAGAAGAAAAATATATGTCTAAAAATAACAATGTCATATCAAAATAACTT
TGAAATTCAAGAGTTTATGTGATCAATAATTTCTGAAGGTCCAACAATTT
GTTGGCCTTCAAGGCTTCACCAACAGGCCAAAACAGTTCACATTTAGCAT
TAAGACATCCCTAAATGCTCAGAATATACCAAACAATAGATATATACCGC
CAATGCAATCCAGTAGAGTCAAAACTCATAGATATAATCTGAGAAACCAA
ATCTGCAAAATCTGAACCATCTGTGTGATTGTCCGATGCCCTGAAAACGG
CTCTAGATACTCCAGAGAAGTGGATGTTGTACTTGACAAAAAGCTGTTGA
CTCTCAAAAAATATTAGAGAATCAGAAATACAACACATAAAAACAATAGA
TATAGGAAATCTTACCTCATTAATTGCTTTCAGGGCTTTCAGTGATTCAT
GGTGGGAACTACAAGATAGAGAAAAGAGGTGGTAATTTATATCACAAACA
AGTAACAAACAACTGCAAAAACAAGCAAGTATGGCCAAATAAACAGTGGG
GTTTCAAGGTCACCTAGAAAGAATTCCAAGAAGAAAGGATGATAATGCTT
TTGGATCCTGAAATGAAAGTAATGTGTATCAGAAGTAAAAACTTCCAAAT
TCTTGTTTCAAATCAGTTTGCGCTGAATGACTACCGTTGTCAAATGCTTA
AGAACTGTCTGTGTAGAAAGGACTGCACAAGAACCTAGCACTGCATTCTC
AGGTGCTTTAGGGTTCCGCAAGTTTTCAGTAAGAGAGAGCACACACTCTG
AGATCATAGATGGCCATCTCTTAATCATCTTCAGCAGTGATTTTCCAGCA
AGTCTGGACACCAAATCAGCTTGTAAACCAGATAGCATATACTGATAAAC
ACTTATGGATGATAGGTAATTCAAACAAATGAAAGTATATCAACTGTAAC
AAGAAAACAGGAAAGACCTGAGAGAGTGCCAGAATATATATATATATATA
TATATTAAAACACACTAAGACAGAAAATGTACAGATAACAGTTGAGCAAC
TCTAATCCCCCCCCCCCTTTTAACCAAAACTAATTTCTCCTGAGAGAAAA
AGGTCACAACGCAGACCATTTTGATCATATAACATAGAACACTGGATAAC
TTACGCGCGAACAGTCTCATAGCTATGCAAAGAGAGGTTCAGTAGATCTT
CCATTAGAAGAATTGCATCTTCTGAAGGAGAAAAGTTCCCACTCGTCCGA
AACAGATGATATGATGCTTGTGACGACCTCCATGTGCTATGCATGTATGC
TTTGTCAATAAGAGCCCACCTCGGCCTGAAAACCAAGAAAAGATCCTATA
TCTAAATTCAAGGAATTTAATACAAAGCACTAACAGTAACTCCAGCAATC
TCATAATAAAATTTCTTGCCTTTTCTTTCCTTTAGAATGAGATGACACAA
TGAAATTTATTGGAGGCTCTATAATGGCAGCAGATTCCAACTTCCAAGCC
TGCCTGTGATTTGACCATTCATCATACTCCAAACTTCCTGCTTGAAAAAA
GGATGTCAAAAGTAGGCTCTAAGCAAATACTCCTCTAAGCAACACTAACA
AAGTTCCAAGAATTCAATTCATTCAGATATAATCACTGTACCATAATTTC
CCAGTGCATCCATGATACGAATAATAAGTATCAACAGGATGCTGTCATCT
GATTTTTCCTCCAACAGGTACCTGCCAATGCACAAAATAATATTTAGAAA
ATCAGAGCCTCTGTAATTGGCAAAGTGAAATATAAAGTACTTCTAATTTA
AATATTACTTGCAAGCTGTGTGAATAATCTTAGCAGCTTTTACACGCAAT
TCAATGCTTCCAACAGTTGAACCTGTTGCTCCAGCTATCAAGAAAGAAGT
ATGACTTGGGTCTTCAACAATCCCATTCCTGGAGGATGGGCTGAAATCAG
GTAAGCAAGATAAAACACCTTGCAATGAAGAATCAATACGTAAAAGAGTG
ACTTTCAAGTGCTCTTTTTCATTTCCTGCCGACAATTGCATACAATTAGC
AAATAATAATAATTATTGTTAATATTATCATAATAAAAGCAATAAAACAA
TCTTAGCATAAATTTCATATTAATGTAATTCTATGTAAGAAGTTTCATGA
TCTCAACCACTCATTAACTTCTAAGCATATACCATGAAACTAGCAAAATT
GATATCTGTAGCCAGATATTACTTAAATAAAAATATTTGATATGTCAACA
GATAAACTCAGGATAAGGGGACAACACTATACAGATTTTTCTAAACAATA
AACACCCATTATTCTTAAACACTGTCATTTCCCCAACTCAACAAGAATCT
AAGCTCTCCAAAATAGACACGGTACTAATGGTCACCATCAGAAAATAAAA
GAACGAAAAGAATGACTCAGTGTTACCTGGATCAGAGTGGATTTTGTTTT
GGCATATTCTCAAAAGTTCATCTAAAGCTGATTCAAAATGAAGGTTCAAA
AGTTCATTTGCAAACTGAATTTCTTCATCATTTGGAACATGCCACTTGGG
GCCAATCAATTTTTCATCCCTACTATAATCTTTTGTGCTAATCCATTCTT
CTAATGCTGCAGCAGCAGGATGGCACAACATGCACCTTGGAAACAAAAAT
TTGCAGCCTTTTAATTTATCAATAGTATCAATGCTGGAAGAAGCTAATAA
AAATAATTCACTGAAATTACATGTACGTATAAAAAGATATAAGCTTACTT
ATACTGATCAATAGGATAATAAACAACCACACTTCCAAGGACAGATCGAA
GAAGATGATCACCAGCTCCATTAACCTGTCATGTGTGCGATTTCAGCAGA
GAAAATAGAAAAGAATCATAATATATCTACAAAAAGATATGACATCCTCC
TCCAAACATAAAGCTAAAACAAGCCAACTAGAGAAAAAATGAAACCTTCC
ACGAGGGAGATTCAAAAGCAGACTCAATAACTTCTTTAATCTGTTCCTTG
CAGCGAAGAAGTGCAGGACCTCCATAGCTGATGGCAACCGACAATATTTT
CAATTGATAATCAATTGCTGTTTCAAGAGCCGGAGACAGTGCTGGTTTTG
CCTGGGAAGAATCAATCAACTTCCATATCAAGAAAGTGCAAGATAAAAGC
TAATAAAACAAACCATTCAACAAATAGAAAACCTTGGCTGAAACAGATGA
ATCAGGGATTCCTCTTCCTCCAAACCCTGTAGTAGGAGTTCCTTGCAAAG
ATGATATAACAGATGACAAAATTGGCTCAACAAGAGAACCAACTGCCTCA
TCTGGATTTGAATGAACACATGCACAACAAAGCAGTCCAACCTCTGCTAC
TGCTCCAGGTAGAATATTTGTCCTGACAAACTTTGAAATTTTCTTCAAAG
CCTGTTAACAAAAAGAATATTTATAAAATTATCTCTTACAAATAATAGGA
GGGTCTTCTTAACTTTCTATTTAAAGGCAAAATGAAACCTGATTGTATAG
TGATTTCGAGAGCCTGCCAAGCAAGATTTCAAGCATGCAATAATAGTAAG
GACCATCCTCAACCAGAAATGTCCCAGATGTTCCTGATGAATGTAAGCCT
TCATTCCTGTCAAACAAATAACCAGTCAACCTTGAGGGGAGAGTCAGAAA
CCAATAGGAACCTAAGTATTTATAGGTATTAGAAAGGAGGGCAATTAAAA
AGAGAGCTGCAATTGAACGCCATTACTTACAGAACAGTACTGGGTTCCAA
ATGTTGAAGTAATGAAAATAGGCGACAAAAGAATTCATCCAACCATTCAG
AAAGGCGGCTTGTTGGCATGAATGACAGATCATTCTTTTCATCATCCAAA
GTTGCAATCTGTGTTTACAGGTATATTGGCACCATGTTCACAAATTATTA
ACAAAGAAGTATGATTGCTACAATTGTCTAGGCCATTTGGAACTTACATT
CGAGAATATTGAACCAATTAACTGCAAGGTTGCCAAGGTTTTGGGAGGAT
CATTGGCATCCATGCCAAGTAATGCATTGGATAATGAAATCATCAAAAGA
TCAAGGAAAGTATCATCATTACCACCAAAATCAACCAGTTTTGAAGTTGA
TAAGGATGTGAGGAACAACGAGCGTCCCGCAAATGCCACAGACATGACAG
CCGTTTTCAACTGGTGGGTGGCAGTCATCTGACTAGATGTAAAAGTGGGC
AGCAGAGAAGTTAATGTGATGAAAGGAGCAGAATTCAGAAAAGTGAAGAG
TAGTACTAATCATTCAATCAAACAGGAATACTTCCTTGACAAATAACCTT
TTGCAAGTTTAAACAACCACTCATCAATTAATATCTCAATGTTTTTAGCA
GTAAAAAAAAAAACCCATAAAACATTACTAACCGTCTCCAAGGCCAGACG
GAACCGAGATGCTAAAAATGGAAGAACCAAAGAGGGCTCCACATATGATA
AAATAGAAGTTGCCGCAGCAACTGTCTCAGATAGATGCTCATTCTTGCTA
TATTGCCCACGGTCTATTAACTTCAGCAGCACAGTAACAAAAGAACTCCT
CTCCAATTTTCCTAGAAACAATTCAGCTTGTCCATCATTATCTGTGGTCC
TGTAGAACAAAAATTTGAATAGGACCAGTCTAAAACAAGTTAAAGCAAAT
ACATAATATATATGTTGGTATATTCTTACTGTTGCTCATGCTGTAAGCGC
TTCTGGAATGTAATTACTAAATAAAGCAAAAACCGCTCCAAGGAATAGGT
CCAGCGACCACCATTAGAGGGATGGTAATATCTGGAACATCAGACCAGTT
AATAACCAATAATTAGATTTTACTAACTATTCACATGCTTCATACACAAT
AACTTGGGTATTAGAATCAGTGAACAAACTGTTCCAAGAGGTTGACCAAT
TTCTCAAAGTGTTCCTGCGCTGAACTTCCAGGTCTTAGTAAATATACCTG
CAGTTGCAATTAGGAAGAAAATTCAAAATCCAAGAATCATTGACACGTTA
TTATCCATAAATTCTGTGAAATGCAACCTGTATATTGATCTTACAATTGA
TTTTGAAATAGCCTTTGCTGGGGTACTCGTTTTGTTGGAGAATAAAAATC
TCGTATTCCGGGGAACATCAACAGAAAAGGGATATGACCCACTTCCATTT
GCCACAGGAACCTGTAATTGCCAGATCAAAGCATTAAACCAAGCATACCA
AATTGTTTTATACAATAGATGGATACAGGAGAAAATCCAGAAAAGAAAAT
CCCGATCGAAAATCTTATCTAGAGAGAAAAAGAAAGAATTCAGTAACTTT
TAATAGTTACAATCACAGGTCATAACATTTTAGTATGTTACTAATATTCT
CTTCAGCTGTCACACTTTCAAAATTTGAGAGATGTAGCAGTGAGTTAGAA
ACCCAAGTTTATCCCAAATATTCCCTACTTCCCTCTTTTAATGTTATATT
AGTGTATACTCCATAATGAAGCATGCAAGCCACCTGACTCTCAATGCTTC
AAAATGCAATTTTGATTGCACATTCATTACCTTAACAAGCATTAATGATA
CCAGATACTAGTTAATGTCTATTTCAAGGATGCCAACGTTTCAATTGAAT
TCAACTCTTAGGTATCACAATTCACAGCACCTTTTAAATGCTAGGGATTG
AAAAATAATGGACTGGACCTGTTTGGTCCATTGTTGCAGTCAGATATTAG
TGTATAGCAGTCAAATTTTAGCAACTGGTAGCCAAGCTTTTAGGCTCCAG
CTATTAGCATTACAGTCATATTTTGAACCACTGGATTTTAAAAGATGCTC
CAAACACCTTATGTTGGCAATTACAAGGCCAAAAACTCAGCCAAACACAC
ACTTCATCTGTGAACTAGAAACAAGAAAATTTGCAATTACTTCTGATAAT
CTATGATATATTTAATTTTGAGAATTTTTCTATAACTTTTGCAAAACTTC
CCAATTTTTTTTGGAAGCATCAAGACATATTACTACTAGGAATATCAAAC
CTTCTTAGGAATATTGATTTTATTAAGAATTTTAGTTGCTTCTAAAATAG
TAATTTAAAAGAAAGGGCTTGTCCCAAAATATGACAACTCATGAAGAAGT
TAAAATTCAAGAAGAATGGCAGCAATTATGCACCATAAGGATTTTCAACA
TAATAAAGACAGCTAAATCTATAAATTAGAAAATTTTAAAAAGAAAAAGA
AAAATTCTAAGGCATATTTCAATGTCTACAAGTTAAAGATTCTCGTCTTT
TGGCATTACAAAACTCAAAGTCCAGTTTTCTCAATCGAAGGAGAATCATA
TGGACAAAGAAAGAGAAATTTGCAAATTATGCTTATATATTTTTATGAAA
ATTGATTTAGGACCTTCATATTTAGGAAACACGGAACTGTACCATCATCT
GTTTTAGCTTAGTAGAGAAACTCATTATTAGAAACCTATTTGCTTCCCAT
CTAATAATCATATGGAATTTTCCAATTAGGGTTCACAATCTTTGTTGAAC
AAGGGAAGTGCTTTACCTTAATGGGTAAAGACCTATGAAGCTTAATTTCA
TTTCCATAAGTTTTTTATTGAAATATGAGTTTACCATAAATGCTTAATAG
AAGGCATATTTACCTAGCCTGAGATTCCTCTTCTTTCTGCCATTACCTAT
CTTGTTAGCTGCATAACTCTTATTTTTCTTGATCTTTATTTCTATATTTA
GTCTCTGCTAAATGCAGGCAACAGAATACTACAAAACCAACCTTCTTTTC
CCTCAAACCTCAGCCCCTTCACAAGCTATATAAATGTAACCCCCTAAAAT
CCACGAATAATTACAGTTTTCCCAACCCAAAAGCAGAAATCGTAACCAAA
TAATCCAACCTGTTCGATATACCATCATTCTAGTTAGCAAAGAATTTTAT
TGAACTCAGTCTCCATCCCTACCATCATCACAGACTATAAAAACAGATGG
TCAGGTATAATCGTACATCCATTTTGGTCAGGTATAATCCTACATCCACT
TTAGTCCAGTATCCTACACATCAAGCAAATGATGTTCAAGTTCAACCACA
TGATGCAGACCAGGGATAAGCTATTAACCTAGCTACACACATGCATAAAC
TCACCTCAAACATATTTAGGTATCTGGTGAAAAGTGTTGGCAAGAAGCCT
TCCCAGTTGACAAAGCTACAGTTTTTTATAACACGTGCTATGACAGCTGC
CCACTGGCTGTTCCAAAATTGGCAATTTGGTATTGAGTCCCACAGTTCCA
AACTCTTTTCAACCCAATCCCTGACAGGACATAGATATGATGTAAATGCT
TCAATAATAAATCAAGAAATCATGAATATAAGAGTTCCAAAAACATGGTG
CTCCCTACTCTGTATAGAAGTCCTGGTTGTCCAAGTTGGTGGGTAGAAAA
AGTCTCACAAACCCAGATCCTTCAAATGATGAATTATGCCATGGATTTTC
CAATAGGGAACTGTAAATATTGAATAAAGAAATTGTGTAAGTTTGGTGAA
CTTCAGGTAGTTAATGATGTGCAAATTGAGCACTTCAATTTTTTTTGTGT
GTGCAGGATTTTTGTCTCAGTTGCTTGAACATCAAATAGGTCAACTAATA
TTGTTATATTGCAGATTATTCTAAATGCATATTAAATATCAAGCCTAAAA
GAACAAAACAAGTACCTACTCATAGTCAATAAAGGCGCACATCAGGCTTT
CCAACATCATATAGGCTAACGAATATTGTTATATTGCAAAATATTCTGAA
TACATGCTAAATATCAAGCCTGAACAATAAATCAACACCTACTCATAGTT
ATTAAAGGTACACCTTAGGAATGACTCAAACTCAAGTTTCACCAGGCTCC
AATCCCAATGCCTCTACATGAGAAAGCAGGCGACACCAGGAACTCGGCTT
GTTCACCTAGGGCTGCGCCTTCTTCCTTGAGTAATGCTCAAAAAAGGTGT
CTTATTCGTTTCGAACTTAGGACAACAAATATCACCATTCTACTCAAAAT
TTTGCAATCCACCAGAATCAAATAATGACATGCTATTAAGTTTTCAAAAT
TAGTATTGTAATCACAGGTGATAACTAGTCGCCAAAATCTCATCAAACAC
TGATGATTGCAAACCTCCCATATTTCCATTTCCAACACTCATGGTCCTTT
TACTCCCTCTCCTCATACGTTGTTTTAAATATTCTCTTATTATCCTTCTC
ATCTTAACTACCTTTTGGACTCCTCCATTTTCTAATACATCTGAATTGTC
CTCCTTAAAATAACGTTAACAATTCTATGTGGGTCCTTTATTTCAATACT
TTGCTAATATTGCTTCTTTAAAAAAAAAAAGACACAACATACTATTTAGT
AACTATTTCTTGATTATTTGCTATCTATTTCTAAAGAAAAGTAACATTAA
ATTGTTAATTACTTTAGATACTCTATTTTTAGGTTATCTAAAATTGCTTT
CTCTTTTTTTTTCCAAAAACATTTACAGTGCTATTTGGATTTATTTGTGA
ATATAAAAAAGGGCGTTGTTTTTTAATGTCCAAATTTTGGATTTATTTTA
TTTTCAAACAGAGTTCTAAAAAATGACCTAATGTAACTTCTATATTCAGT
TTATATTCTTTTATGCTTATTAATGCTTTGTAGATTGGTCACATCTATTA
CTATTTTATTTTTATTGAATTTTATATTTATGAGCCTCATCTCATTCTGG
CACATGCCTGCACCTTATGCCTAGACCTCAAGACCCCTTTGTAACTTATT
ATGCCTTGTGCCTTTAATAACTATGCATCTACTAGAATTTAGTACCTGAT
TTAACTTTAAATGTAACCCAAAATTAAGTTGAAACAAGCCAAAAACATAA
AATTTCTCTTTCAGATTATGTTGGAACTCTAACATCATGGTTATGCAAAC
CACAAGCTTTTGACAAAATTAAAGACTGTCCAATTATGCTTACCTAAACT
CAGACCATATATCCGAGGCAGAACCTGCAGGAAAGAATCTCCTGCAGGAT
CTAACAAGTGATGTAACAGTCTCAAAGTGCCGTTGTCTCAACCTCCATCC
TTCTGGACCTGTATTCCTGTGATGAACAGTAAGTTTTTGAGCAGCCGTAG
GTAATTGAGAGAAGAAACGGAGGACAAAGAAAAAGGATGCACTGTCAGCA
TTAGAAAAATCTTGCACTACTAATTTCATCAATCTACATATGAATAAAAA
ATGCAATAGAGTAAATGCATAATATAACATCAAACTCGATCACTCAGTAA
CTCACCTTGAGAAATGAGTATGAACCAGAGTATCATACAACGGCCGCCAT
TGCACTTTTAAAGAATGCAACTTCTTTCTGAATTTATTAAGCACTCTAAC
CAAGACACTTCCCCATCGAACCTAATTCACCCATTTACTTAGATATAGAA
TAAAAAAACACAAGAAAAACAACAAAGAGGGGAATTCTTTAAAGAATGAA
AAACCTGGGCATAAAGCTTATTCTGAGATATATTGAACAAATGAATTCCA
ATTTCCACAAGCTGATTCACATCTTCCAAAGCCACTTCACTTTTCGCCTT
TATGAAGCTGCATATCCAATTAAATAAACATTAAAAGAATAGAAGTAATT
TCTCAACTCCATTGGCATCCAAGAAACAGTAAAATTCCACAAAACCAGAA
CAATCATCATAAAACCTCAAATTCGAAAACCTCAATTGCAAAATTGAACT
CGTAAATCGAAAAGCAATACAAAGATAAAATACTAACAGGTCGATAACAG
AAATCCATTTAAGAGTGGCATAGACAGATTCAGGATCGTCGGGCTTATAA
GAGGCCTTAACGGAGTTGATCACTCGAGAGAAAGATTCAGTCTCTTTCTT
GGTCTCCTCGGCCACCGGCGGTGGCAGCCATGCATTGTAGAGATGCATTT
CCTTCTTCTTCTACTTAGTCTTCTTCTTCGGTATGCGTTCGCTGGGGATC
GAAACGGAATGAAAATGAATTGAAGGTGAGTGGTGAGGGGCTGCAGCGTA
TTTATAGTAAGT
back to top

mRNA from alignment at Chromosome01:956640..970151-

Legend: five_prime_UTRCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>Manes.01G005500.1.v6.1 ID=Manes.01G005500.1.v6.1|Name=Manes.01G005500.1|organism=Manihot esculenta|type=mRNA|length=13512bp|location=Sequence derived from alignment at Chromosome01:956640..970151- (Manihot esculenta)
ACTTACTATAAATACGCTGCAGCCCCTCACCACTCACCTTCAATTCATTT TCATTCCGTTTCGATCCCCAGCGAACGCATACCGAAGAAGAAGACTAAGT AGAAGAAGAAGGAAATGCATCTCTACAATGCATGGCTGCCACCGCCGGTG GCCGAGGAGACCAAGAAAGAGACTGAATCTTTCTCTCGAGTGATCAACTC CGTTAAGGCCTCTTATAAGCCCGACGATCCTGAATCTGTCTATGCCACTC TTAAATGGATTTCTGTTATCGACCTGTTAGTATTTTATCTTTGTATTGCT TTTCGATTTACGAGTTCAATTTTGCAATTGAGGTTTTCGAATTTGAGGTT TTATGATGATTGTTCTGGTTTTGTGGAATTTTACTGTTTCTTGGATGCCA ATGGAGTTGAGAAATTACTTCTATTCTTTTAATGTTTATTTAATTGGATA TGCAGCTTCATAAAGGCGAAAAGTGAAGTGGCTTTGGAAGATGTGAATCA GCTTGTGGAAATTGGAATTCATTTGTTCAATATATCTCAGAATAAGCTTT ATGCCCAGGTTTTTCATTCTTTAAAGAATTCCCCTCTTTGTTGTTTTTCT TGTGTTTTTTTATTCTATATCTAAGTAAATGGGTGAATTAGGTTCGATGG GGAAGTGTCTTGGTTAGAGTGCTTAATAAATTCAGAAAGAAGTTGCATTC TTTAAAAGTGCAATGGCGGCCGTTGTATGATACTCTGGTTCATACTCATT TCTCAAGGTGAGTTACTGAGTGATCGAGTTTGATGTTATATTATGCATTT ACTCTATTGCATTTTTTATTCATATGTAGATTGATGAAATTAGTAGTGCA AGATTTTTCTAATGCTGACAGTGCATCCTTTTTCTTTGTCCTCCGTTTCT TCTCTCAATTACCTACGGCTGCTCAAAAACTTACTGTTCATCACAGGAAT ACAGGTCCAGAAGGATGGAGGTTGAGACAACGGCACTTTGAGACTGTTAC ATCACTTGTTAGATCCTGCAGGAGATTCTTTCCTGCAGGTTCTGCCTCGG ATATATGGTCTGAGTTTAGGTAAGCATAATTGGACAGTCTTTAATTTTGT CAAAAGCTTGTGGTTTGCATAACCATGATGTTAGAGTTCCAACATAATCT GAAAGAGAAATTTTATGTTTTTGGCTTGTTTCAACTTAATTTTGGGTTAC ATTTAAAGTTAAATCAGGTACTAAATTCTAGTAGATGCATAGTTATTAAA GGCACAAGGCATAATAAGTTACAAAGGGGTCTTGAGGTCTAGGCATAAGG TGCAGGCATGTGCCAGAATGAGATGAGGCTCATAAATATAAAATTCAATA AAAATAAAATAGTAATAGATGTGACCAATCTACAAAGCATTAATAAGCAT AAAAGAATATAAACTGAATATAGAAGTTACATTAGGTCATTTTTTAGAAC TCTGTTTGAAAATAAAATAAATCCAAAATTTGGACATTAAAAAACAACGC CCTTTTTTATATTCACAAATAAATCCAAATAGCACTGTAAATGTTTTTGG AAAAAAAAAGAGAAAGCAATTTTAGATAACCTAAAAATAGAGTATCTAAA GTAATTAACAATTTAATGTTACTTTTCTTTAGAAATAGATAGCAAATAAT CAAGAAATAGTTACTAAATAGTATGTTGTGTCTTTTTTTTTTTAAAGAAG CAATATTAGCAAAGTATTGAAATAAAGGACCCACATAGAATTGTTAACGT TATTTTAAGGAGGACAATTCAGATGTATTAGAAAATGGAGGAGTCCAAAA GGTAGTTAAGATGAGAAGGATAATAAGAGAATATTTAAAACAACGTATGA GGAGAGGGAGTAAAAGGACCATGAGTGTTGGAAATGGAAATATGGGAGGT TTGCAATCATCAGTGTTTGATGAGATTTTGGCGACTAGTTATCACCTGTG ATTACAATACTAATTTTGAAAACTTAATAGCATGTCATTATTTGATTCTG GTGGATTGCAAAATTTTGAGTAGAATGGTGATATTTGTTGTCCTAAGTTC GAAACGAATAAGACACCTTTTTTGAGCATTACTCAAGGAAGAAGGCGCAG CCCTAGGTGAACAAGCCGAGTTCCTGGTGTCGCCTGCTTTCTCATGTAGA GGCATTGGGATTGGAGCCTGGTGAAACTTGAGTTTGAGTCATTCCTAAGG TGTACCTTTAATAACTATGAGTAGGTGTTGATTTATTGTTCAGGCTTGAT ATTTAGCATGTATTCAGAATATTTTGCAATATAACAATATTCGTTAGCCT ATATGATGTTGGAAAGCCTGATGTGCGCCTTTATTGACTATGAGTAGGTA CTTGTTTTGTTCTTTTAGGCTTGATATTTAATATGCATTTAGAATAATCT GCAATATAACAATATTAGTTGACCTATTTGATGTTCAAGCAACTGAGACA AAAATCCTGCACACACAAAAAAAATTGAAGTGCTCAATTTGCACATCATT AACTACCTGAAGTTCACCAAACTTACACAATTTCTTTATTCAATATTTAC AGTTCCCTATTGGAAAATCCATGGCATAATTCATCATTTGAAGGATCTGG GTTTGTGAGACTTTTTCTACCCACCAACTTGGACAACCAGGACTTCTATA CAGAGTAGGGAGCACCATGTTTTTGGAACTCTTATATTCATGATTTCTTG ATTTATTATTGAAGCATTTACATCATATCTATGTCCTGTCAGGGATTGGG TTGAAAAGAGTTTGGAACTGTGGGACTCAATACCAAATTGCCAATTTTGG AACAGCCAGTGGGCAGCTGTCATAGCACGTGTTATAAAAAACTGTAGCTT TGTCAACTGGGAAGGCTTCTTGCCAACACTTTTCACCAGATACCTAAATA TGTTTGAGGTGAGTTTATGCATGTGTGTAGCTAGGTTAATAGCTTATCCC TGGTCTGCATCATGTGGTTGAACTTGAACATCATTTGCTTGATGTGTAGG ATACTGGACTAAAGTGGATGTAGGATTATACCTGACCAAAATGGATGTAC GATTATACCTGACCATCTGTTTTTATAGTCTGTGATGATGGTAGGGATGG AGACTGAGTTCAATAAAATTCTTTGCTAACTAGAATGATGGTATATCGAA CAGGTTGGATTATTTGGTTACGATTTCTGCTTTTGGGTTGGGAAAACTGT AATTATTCGTGGATTTTAGGGGGTTACATTTATATAGCTTGTGAAGGGGC TGAGGTTTGAGGGAAAAGAAGGTTGGTTTTGTAGTATTCTGTTGCCTGCA TTTAGCAGAGACTAAATATAGAAATAAAGATCAAGAAAAATAAGAGTTAT GCAGCTAACAAGATAGGTAATGGCAGAAAGAAGAGGAATCTCAGGCTAGG TAAATATGCCTTCTATTAAGCATTTATGGTAAACTCATATTTCAATAAAA AACTTATGGAAATGAAATTAAGCTTCATAGGTCTTTACCCATTAAGGTAA AGCACTTCCCTTGTTCAACAAAGATTGTGAACCCTAATTGGAAAATTCCA TATGATTATTAGATGGGAAGCAAATAGGTTTCTAATAATGAGTTTCTCTA CTAAGCTAAAACAGATGATGGTACAGTTCCGTGTTTCCTAAATATGAAGG TCCTAAATCAATTTTCATAAAAATATATAAGCATAATTTGCAAATTTCTC TTTCTTTGTCCATATGATTCTCCTTCGATTGAGAAAACTGGACTTTGAGT TTTGTAATGCCAAAAGACGAGAATCTTTAACTTGTAGACATTGAAATATG CCTTAGAATTTTTCTTTTTCTTTTTAAAATTTTCTAATTTATAGATTTAG CTGTCTTTATTATGTTGAAAATCCTTATGGTGCATAATTGCTGCCATTCT TCTTGAATTTTAACTTCTTCATGAGTTGTCATATTTTGGGACAAGCCCTT TCTTTTAAATTACTATTTTAGAAGCAACTAAAATTCTTAATAAAATCAAT ATTCCTAAGAAGGTTTGATATTCCTAGTAGTAATATGTCTTGATGCTTCC AAAAAAAATTGGGAAGTTTTGCAAAAGTTATAGAAAAATTCTCAAAATTA AATATATCATAGATTATCAGAAGTAATTGCAAATTTTCTTGTTTCTAGTT CACAGATGAAGTGTGTGTTTGGCTGAGTTTTTGGCCTTGTAATTGCCAAC ATAAGGTGTTTGGAGCATCTTTTAAAATCCAGTGGTTCAAAATATGACTG TAATGCTAATAGCTGGAGCCTAAAAGCTTGGCTACCAGTTGCTAAAATTT GACTGCTATACACTAATATCTGACTGCAACAATGGACCAAACAGGTCCAG TCCATTATTTTTCAATCCCTAGCATTTAAAAGGTGCTGTGAATTGTGATA CCTAAGAGTTGAATTCAATTGAAACGTTGGCATCCTTGAAATAGACATTA ACTAGTATCTGGTATCATTAATGCTTGTTAAGGTAATGAATGTGCAATCA AAATTGCATTTTGAAGCATTGAGAGTCAGGTGGCTTGCATGCTTCATTAT GGAGTATACACTAATATAACATTAAAAGAGGGAAGTAGGGAATATTTGGG ATAAACTTGGGTTTCTAACTCACTGCTACATCTCTCAAATTTTGAAAGTG TGACAGCTGAAGAGAATATTAGTAACATACTAAAATGTTATGACCTGTGA TTGTAACTATTAAAAGTTACTGAATTCTTTCTTTTTCTCTCTAGATAAGA TTTTCGATCGGGATTTTCTTTTCTGGATTTTCTCCTGTATCCATCTATTG TATAAAACAATTTGGTATGCTTGGTTTAATGCTTTGATCTGGCAATTACA GGTTCCTGTGGCAAATGGAAGTGGGTCATATCCCTTTTCTGTTGATGTTC CCCGGAATACGAGATTTTTATTCTCCAACAAAACGAGTACCCCAGCAAAG GCTATTTCAAAATCAATTGTAAGATCAATATACAGGTTGCATTTCACAGA ATTTATGGATAATAACGTGTCAATGATTCTTGGATTTTGAATTTTCTTCC TAATTGCAACTGCAGGTATATTTACTAAGACCTGGAAGTTCAGCGCAGGA ACACTTTGAGAAATTGGTCAACCTCTTGGAACAGTTTGTTCACTGATTCT AATACCCAAGTTATTGTGTATGAAGCATGTGAATAGTTAGTAAAATCTAA TTATTGGTTATTAACTGGTCTGATGTTCCAGATATTACCATCCCTCTAAT GGTGGTCGCTGGACCTATTCCTTGGAGCGGTTTTTGCTTTATTTAGTAAT TACATTCCAGAAGCGCTTACAGCATGAGCAACAGTAAGAATATACCAACA TATATATTATGTATTTGCTTTAACTTGTTTTAGACTGGTCCTATTCAAAT TTTTGTTCTACAGGACCACAGATAATGATGGACAAGCTGAATTGTTTCTA GGAAAATTGGAGAGGAGTTCTTTTGTTACTGTGCTGCTGAAGTTAATAGA CCGTGGGCAATATAGCAAGAATGAGCATCTATCTGAGACAGTTGCTGCGG CAACTTCTATTTTATCATATGTGGAGCCCTCTTTGGTTCTTCCATTTTTA GCATCTCGGTTCCGTCTGGCCTTGGAGACGGTTAGTAATGTTTTATGGGT TTTTTTTTTTACTGCTAAAAACATTGAGATATTAATTGATGAGTGGTTGT TTAAACTTGCAAAAGGTTATTTGTCAAGGAAGTATTCCTGTTTGATTGAA TGATTAGTACTACTCTTCACTTTTCTGAATTCTGCTCCTTTCATCACATT AACTTCTCTGCTGCCCACTTTTACATCTAGTCAGATGACTGCCACCCACC AGTTGAAAACGGCTGTCATGTCTGTGGCATTTGCGGGACGCTCGTTGTTC CTCACATCCTTATCAACTTCAAAACTGGTTGATTTTGGTGGTAATGATGA TACTTTCCTTGATCTTTTGATGATTTCATTATCCAATGCATTACTTGGCA TGGATGCCAATGATCCTCCCAAAACCTTGGCAACCTTGCAGTTAATTGGT TCAATATTCTCGAATGTAAGTTCCAAATGGCCTAGACAATTGTAGCAATC ATACTTCTTTGTTAATAATTTGTGAACATGGTGCCAATATACCTGTAAAC ACAGATTGCAACTTTGGATGATGAAAAGAATGATCTGTCATTCATGCCAA CAAGCCGCCTTTCTGAATGGTTGGATGAATTCTTTTGTCGCCTATTTTCA TTACTTCAACATTTGGAACCCAGTACTGTTCTGTAAGTAATGGCGTTCAA TTGCAGCTCTCTTTTTAATTGCCCTCCTTTCTAATACCTATAAATACTTA GGTTCCTATTGGTTTCTGACTCTCCCCTCAAGGTTGACTGGTTATTTGTT TGACAGGAATGAAGGCTTACATTCATCAGGAACATCTGGGACATTTCTGG TTGAGGATGGTCCTTACTATTATTGCATGCTTGAAATCTTGCTTGGCAGG CTCTCGAAATCACTATACAATCAGGTTTCATTTTGCCTTTAAATAGAAAG TTAAGAAGACCCTCCTATTATTTGTAAGAGATAATTTTATAAATATTCTT TTTGTTAACAGGCTTTGAAGAAAATTTCAAAGTTTGTCAGGACAAATATT CTACCTGGAGCAGTAGCAGAGGTTGGACTGCTTTGTTGTGCATGTGTTCA TTCAAATCCAGATGAGGCAGTTGGTTCTCTTGTTGAGCCAATTTTGTCAT CTGTTATATCATCTTTGCAAGGAACTCCTACTACAGGGTTTGGAGGAAGA GGAATCCCTGATTCATCTGTTTCAGCCAAGGTTTTCTATTTGTTGAATGG TTTGTTTTATTAGCTTTTATCTTGCACTTTCTTGATATGGAAGTTGATTG ATTCTTCCCAGGCAAAACCAGCACTGTCTCCGGCTCTTGAAACAGCAATT GATTATCAATTGAAAATATTGTCGGTTGCCATCAGCTATGGAGGTCCTGC ACTTCTTCGCTGCAAGGAACAGATTAAAGAAGTTATTGAGTCTGCTTTTG AATCTCCCTCGTGGAAGGTTTCATTTTTTCTCTAGTTGGCTTGTTTTAGC TTTATGTTTGGAGGAGGATGTCATATCTTTTTGTAGATATATTATGATTC TTTTCTATTTTCTCTGCTGAAATCGCACACATGACAGGTTAATGGAGCTG GTGATCATCTTCTTCGATCTGTCCTTGGAAGTGTGGTTGTTTATTATCCT ATTGATCAGTATAAGTAAGCTTATATCTTTTTATACGTACATGTAATTTC AGTGAATTATTTTTATTAGCTTCTTCCAGCATTGATACTATTGATAAATT AAAAGGCTGCAAATTTTTGTTTCCAAGGTGCATGTTGTGCCATCCTGCTG CTGCAGCATTAGAAGAATGGATTAGCACAAAAGATTATAGTAGGGATGAA AAATTGATTGGCCCCAAGTGGCATGTTCCAAATGATGAAGAAATTCAGTT TGCAAATGAACTTTTGAACCTTCATTTTGAATCAGCTTTAGATGAACTTT TGAGAATATGCCAAAACAAAATCCACTCTGATCCAGGTAACACTGAGTCA TTCTTTTCGTTCTTTTATTTTCTGATGGTGACCATTAGTACCGTGTCTAT TTTGGAGAGCTTAGATTCTTGTTGAGTTGGGGAAATGACAGTGTTTAAGA ATAATGGGTGTTTATTGTTTAGAAAAATCTGTATAGTGTTGTCCCCTTAT CCTGAGTTTATCTGTTGACATATCAAATATTTTTATTTAAGTAATATCTG GCTACAGATATCAATTTTGCTAGTTTCATGGTATATGCTTAGAAGTTAAT GAGTGGTTGAGATCATGAAACTTCTTACATAGAATTACATTAATATGAAA TTTATGCTAAGATTGTTTTATTGCTTTTATTATGATAATATTAACAATAA TTATTATTATTTGCTAATTGTATGCAATTGTCGGCAGGAAATGAAAAAGA GCACTTGAAAGTCACTCTTTTACGTATTGATTCTTCATTGCAAGGTGTTT TATCTTGCTTACCTGATTTCAGCCCATCCTCCAGGAATGGGATTGTTGAA GACCCAAGTCATACTTCTTTCTTGATAGCTGGAGCAACAGGTTCAACTGT TGGAAGCATTGAATTGCGTGTAAAAGCTGCTAAGATTATTCACACAGCTT GCAAGTAATATTTAAATTAGAAGTACTTTATATTTCACTTTGCCAATTAC AGAGGCTCTGATTTTCTAAATATTATTTTGTGCATTGGCAGGTACCTGTT GGAGGAAAAATCAGATGACAGCATCCTGTTGATACTTATTATTCGTATCA TGGATGCACTGGGAAATTATGGTACAGTGATTATATCTGAATGAATTGAA TTCTTGGAACTTTGTTAGTGTTGCTTAGAGGAGTATTTGCTTAGAGCCTA CTTTTGACATCCTTTTTTCAAGCAGGAAGTTTGGAGTATGATGAATGGTC AAATCACAGGCAGGCTTGGAAGTTGGAATCTGCTGCCATTATAGAGCCTC CAATAAATTTCATTGTGTCATCTCATTCTAAAGGAAAGAAAAGGCAAGAA ATTTTATTATGAGATTGCTGGAGTTACTGTTAGTGCTTTGTATTAAATTC CTTGAATTTAGATATAGGATCTTTTCTTGGTTTTCAGGCCGAGGTGGGCT CTTATTGACAAAGCATACATGCATAGCACATGGAGGTCGTCACAAGCATC ATATCATCTGTTTCGGACGAGTGGGAACTTTTCTCCTTCAGAAGATGCAA TTCTTCTAATGGAAGATCTACTGAACCTCTCTTTGCATAGCTATGAGACT GTTCGCGCGTAAGTTATCCAGTGTTCTATGTTATATGATCAAAATGGTCT GCGTTGTGACCTTTTTCTCTCAGGAGAAATTAGTTTTGGTTAAAAGGGGG GGGGGGATTAGAGTTGCTCAACTGTTATCTGTACATTTTCTGTCTTAGTG TGTTTTAATATATATATATATATATATATTCTGGCACTCTCTCAGGTCTT TCCTGTTTTCTTGTTACAGTTGATATACTTTCATTTGTTTGAATTACCTA TCATCCATAAGTGTTTATCAGTATATGCTATCTGGTTTACAAGCTGATTT GGTGTCCAGACTTGCTGGAAAATCACTGCTGAAGATGATTAAGAGATGGC CATCTATGATCTCAGAGTGTGTGCTCTCTCTTACTGAAAACTTGCGGAAC CCTAAAGCACCTGAGAATGCAGTGCTAGGTTCTTGTGCAGTCCTTTCTAC ACAGACAGTTCTTAAGCATTTGACAACGGTAGTCATTCAGCGCAAACTGA TTTGAAACAAGAATTTGGAAGTTTTTACTTCTGATACACATTACTTTCAT TTCAGGATCCAAAAGCATTATCATCCTTTCTTCTTGGAATTCTTTCTAGG TGACCTTGAAACCCCACTGTTTATTTGGCCATACTTGCTTGTTTTTGCAG TTGTTTGTTACTTGTTTGTGATATAAATTACCACCTCTTTTCTCTATCTT GTAGTTCCCACCATGAATCACTGAAAGCCCTGAAAGCAATTAATGAGGTA AGATTTCCTATATCTATTGTTTTTATGTGTTGTATTTCTGATTCTCTAAT ATTTTTTGAGAGTCAACAGCTTTTTGTCAAGTACAACATCCACTTCTCTG GAGTATCTAGAGCCGTTTTCAGGGCATCGGACAATCACACAGATGGTTCA GATTTTGCAGATTTGGTTTCTCAGATTATATCTATGAGTTTTGACTCTAC TGGATTGCATTGGCGGTATATATCTATTGTTTGGTATATTCTGAGCATTT AGGGATGTCTTAATGCTAAATGTGAACTGTTTTGGCCTGTTGGTGAAGCC TTGAAGGCCAACAAATTGTTGGACCTTCAGAAATTATTGATCACATAAAC TCTTGAATTTCAAAGTTATTTTGATATGACATTGTTATTTTTAGACATAT ATTTTTCTTCTTTGGATATTGGCTCAATTTCATGCCTTTTTTTTTCTCTC TCTTGTAAGGTATAACCTGATGGCTAATAGGGTTCTGCTTTTGTTGGCCA TGACATCTAGAAATGAGCCAAGCTTCTCTTCAAAAATACTGAGTGAAACT GCTGGTTAGCAATTTTCTTGTTGGCTTATGGATTGCCACTGTTTTTCTTA CCAGCACTTTCTCTGTTAATGAAAAGGGAGTAGCATTATCAACAATGTCG TTTCCTACCTTTCAGGTCACTTCCTAAAAAGTTTAAAGAGTCAACTTCCT CAGACAAGAATACTTGCAATCTCAGCTCTGAATACTCTTCTAAAAGAATC GCCATATAAGTTGTCAGCTGAGAATCTAGGCGNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACCATAATTTTTAT AAGTTGAAGTTATTTTATGGTTATATTTTGATGTGAATTTTCCCATGGGG CAGGTAAGGGAAGCTATAGGGGTCACCCTGTCCATATTGTGCTCCAATAT TCGCCTTCATTTATCAATTGCTCATAATCATTCAAGTGAAGATGCAAATG CTGACTTTGATAAACTACTAAAAGAGGAAAATTGGGTTCTGTTTCTGACA GAACGAGCTTCTGATGTGGTCACAAATATTCAGAAAACTAGCCCTTTGGA CAATTTAGAGATACCAACACGGACAGTTCCTCAAAATGGGTCCTTGAATG GAGATGCACAGGATGATGTTAAGTGGATGGAAACGGTACTAATTTTTAAA GCAATTAGATTTTTTTTAACTTGATGTATTTATTTATTTTCATTTTAATT TTAACTTTTTTTTTGTTTTGTTTTGTTTTGCTGTAGCTCTTTCATTTTGT CATATCAACACTGAAATCTGGAAGATCATCTTATTTGCTGGATGTCATTG TGCAGTTTCTCTATCCAGTAATTTCCTTGCAGGTGCGTGAGTTATATTTT TCTGCTAGTATGGCTTGAGAATATTTATCATTCCCTTTAGGTGGTGACTG CAGTACCAATACATATATTATTTGATGCAAATTTGCAAATTGAGAACTTT TGTGTTCATCTTAAATATATTTACTCTGTTGCCATGTTCAAATCAGACAC CAGTATAAAAGCTCGTTTCTCAGATTTTACACTTCAAAATAAGCAGTCTT TTTTGGATGCTAATGACATGGCACTCCTCAAAGCTAAACTCTTCACCTCC ATGCCAAATTGAATATTGTTGTTATGGAATATATTGCAATTGCTTTAAAC AATTTCATGTAGAAACTGTATCTGATAAATACTATTGACCTGTTGAAGGA AACATCAAATAAAGACTTATCAACCCTGGCCAAGGCTGCTTTCGAATTGC TAAAATGGAGGATTTTCTGGGAACCTCATCTTCAAAGTGTTGTTTCAGTT ATCCTTACTTCAGCCAATGATCCTAACTGGCGGACCAGATCAGCTACTCT GACATATCTACGTACTTTCATGTATAGGTATAATACTTATTCAAAAAGTT CTGTTTATGCATCAGATTGTTCATATGTGCGAGGCTAAATTGGAGATTCT GGTTCTCTATTTAAGTAATTCTTACAGTATGTCAATATTTTAATGTGCTG TATTTGGTTCTCTAAATTCTTGCGAACAGAAAAATTTCAGTTTCCATGTT ATCATGTGAGACTATGCTTAATACCATCTGCTACAGAGTGGCAATTAACT GACTGGTCCCAATTCACCCTTTTGATGCCCATTTCATAGATGGGATATCA GGCTGGTTGACTAATTTGTAGCCTGTCAAAAAGACGGTCTATGTTATGAT GCAGGGTCTAATGAATTTGTGTACCTTTTTTTTTCTCCCTCTTGTAACAG GCATACTTCTATTCTCTCGAGGATTGAGAAACAACAAATTTGGAGTACTG TTGAGAATTTACTGAGGGACAATCAAGTAGAGGCAAGTTGCTGGTTGAAT CTTGAATTGAAGAGTAGTGTAGATTAGAAGATGTAGATGTGGATGAAGAA TAATCCTTGTCCTTATCAATAGTTTGATAATAAATGTTGATCTCAATGAC TCGCACATGTGATAAAGAAGTTTGAGATTTCTGTGATGGAGAAGTCCTTG ACTAGAGTTAGAGATATATTTTCTTCTAGTCCCTTTTCTAAATAGTTGAT ACCTTGCTTAGGTGAGAGAGCATGCTGCGGCAGTTCTAGCAGGTCTAATG AAGGGCGGGGATGAAGATCTTGCTAAAGACTTCCGTGATAGAGCTTTCAT AGTGGCCAGTACCATTCAAAGGAAGAGAAAGATGAGGTTAGTGGTCTATC TAGTACCCTTTGTTAGTTAAATTTAGTTATTTACCTTCTCATCATGGTTA CAACAATATGGTCTTGTACTCTTTATATGGGGCCTACATGTCTGGAACGG ATTATGCATAAAAGTTACTTTTAAATTTTCTTTTCCATGGCTGAAAGTCA CTAATATAATGTGCTTTTGTGATTCTCATTTTCATGATATGTGCATAGGA TTTATTCCACATTTTTTCTTTTAACATGCTTTTAGTAATTGCATAACCAT TGTTGGTTTGGGATTTCATGCTCTATATTTTGATCCATAAGTTTTATGTA TGAATGCAGGAATTCAAAATCTGGACAATCAATAGCATCTATTCATGGTG CTGTGCTTGCTTTGGCTGCTTCTGTATTATCCGTCCCATATGATATGCCC GGGTATGTTTAG
back to top

Coding sequence (CDS) from alignment at Chromosome01:956640..970151-

>Manes.01G005500.1.v6.1 ID=Manes.01G005500.1.v6.1|Name=Manes.01G005500.1|organism=Manihot esculenta|type=CDS|length=4455bp|location=Sequence derived from alignment at Chromosome01:956640..970151- (Manihot esculenta)
ATGCATCTCTACAATGCATGGCTGCCACCGCCGGTGGCCGAGGAGACCAA
GAAAGAGACTGAATCTTTCTCTCGAGTGATCAACTCCGTTAAGGCCTCTT
ATAAGCCCGACGATCCTGAATCTGTCTATGCCACTCTTAAATGGATTTCT
GTTATCGACCTCTTCATAAAGGCGAAAAGTGAAGTGGCTTTGGAAGATGT
GAATCAGCTTGTGGAAATTGGAATTCATTTGTTCAATATATCTCAGAATA
AGCTTTATGCCCAGGTTCGATGGGGAAGTGTCTTGGTTAGAGTGCTTAAT
AAATTCAGAAAGAAGTTGCATTCTTTAAAAGTGCAATGGCGGCCGTTGTA
TGATACTCTGGTTCATACTCATTTCTCAAGGAATACAGGTCCAGAAGGAT
GGAGGTTGAGACAACGGCACTTTGAGACTGTTACATCACTTGTTAGATCC
TGCAGGAGATTCTTTCCTGCAGGTTCTGCCTCGGATATATGGTCTGAGTT
TAGTTCCCTATTGGAAAATCCATGGCATAATTCATCATTTGAAGGATCTG
GGTTTGTGAGACTTTTTCTACCCACCAACTTGGACAACCAGGACTTCTAT
ACAGAGGATTGGGTTGAAAAGAGTTTGGAACTGTGGGACTCAATACCAAA
TTGCCAATTTTGGAACAGCCAGTGGGCAGCTGTCATAGCACGTGTTATAA
AAAACTGTAGCTTTGTCAACTGGGAAGGCTTCTTGCCAACACTTTTCACC
AGATACCTAAATATGTTTGAGGTTCCTGTGGCAAATGGAAGTGGGTCATA
TCCCTTTTCTGTTGATGTTCCCCGGAATACGAGATTTTTATTCTCCAACA
AAACGAGTACCCCAGCAAAGGCTATTTCAAAATCAATTGTATATTTACTA
AGACCTGGAAGTTCAGCGCAGGAACACTTTGAGAAATTGGTCAACCTCTT
GGAACAATATTACCATCCCTCTAATGGTGGTCGCTGGACCTATTCCTTGG
AGCGGTTTTTGCTTTATTTAGTAATTACATTCCAGAAGCGCTTACAGCAT
GAGCAACAGACCACAGATAATGATGGACAAGCTGAATTGTTTCTAGGAAA
ATTGGAGAGGAGTTCTTTTGTTACTGTGCTGCTGAAGTTAATAGACCGTG
GGCAATATAGCAAGAATGAGCATCTATCTGAGACAGTTGCTGCGGCAACT
TCTATTTTATCATATGTGGAGCCCTCTTTGGTTCTTCCATTTTTAGCATC
TCGGTTCCGTCTGGCCTTGGAGACGATGACTGCCACCCACCAGTTGAAAA
CGGCTGTCATGTCTGTGGCATTTGCGGGACGCTCGTTGTTCCTCACATCC
TTATCAACTTCAAAACTGGTTGATTTTGGTGGTAATGATGATACTTTCCT
TGATCTTTTGATGATTTCATTATCCAATGCATTACTTGGCATGGATGCCA
ATGATCCTCCCAAAACCTTGGCAACCTTGCAGTTAATTGGTTCAATATTC
TCGAATATTGCAACTTTGGATGATGAAAAGAATGATCTGTCATTCATGCC
AACAAGCCGCCTTTCTGAATGGTTGGATGAATTCTTTTGTCGCCTATTTT
CATTACTTCAACATTTGGAACCCAGTACTGTTCTGAATGAAGGCTTACAT
TCATCAGGAACATCTGGGACATTTCTGGTTGAGGATGGTCCTTACTATTA
TTGCATGCTTGAAATCTTGCTTGGCAGGCTCTCGAAATCACTATACAATC
AGGCTTTGAAGAAAATTTCAAAGTTTGTCAGGACAAATATTCTACCTGGA
GCAGTAGCAGAGGTTGGACTGCTTTGTTGTGCATGTGTTCATTCAAATCC
AGATGAGGCAGTTGGTTCTCTTGTTGAGCCAATTTTGTCATCTGTTATAT
CATCTTTGCAAGGAACTCCTACTACAGGGTTTGGAGGAAGAGGAATCCCT
GATTCATCTGTTTCAGCCAAGGCAAAACCAGCACTGTCTCCGGCTCTTGA
AACAGCAATTGATTATCAATTGAAAATATTGTCGGTTGCCATCAGCTATG
GAGGTCCTGCACTTCTTCGCTGCAAGGAACAGATTAAAGAAGTTATTGAG
TCTGCTTTTGAATCTCCCTCGTGGAAGGTTAATGGAGCTGGTGATCATCT
TCTTCGATCTGTCCTTGGAAGTGTGGTTGTTTATTATCCTATTGATCAGT
ATAAGTGCATGTTGTGCCATCCTGCTGCTGCAGCATTAGAAGAATGGATT
AGCACAAAAGATTATAGTAGGGATGAAAAATTGATTGGCCCCAAGTGGCA
TGTTCCAAATGATGAAGAAATTCAGTTTGCAAATGAACTTTTGAACCTTC
ATTTTGAATCAGCTTTAGATGAACTTTTGAGAATATGCCAAAACAAAATC
CACTCTGATCCAGGAAATGAAAAAGAGCACTTGAAAGTCACTCTTTTACG
TATTGATTCTTCATTGCAAGGTGTTTTATCTTGCTTACCTGATTTCAGCC
CATCCTCCAGGAATGGGATTGTTGAAGACCCAAGTCATACTTCTTTCTTG
ATAGCTGGAGCAACAGGTTCAACTGTTGGAAGCATTGAATTGCGTGTAAA
AGCTGCTAAGATTATTCACACAGCTTGCAAGTACCTGTTGGAGGAAAAAT
CAGATGACAGCATCCTGTTGATACTTATTATTCGTATCATGGATGCACTG
GGAAATTATGGAAGTTTGGAGTATGATGAATGGTCAAATCACAGGCAGGC
TTGGAAGTTGGAATCTGCTGCCATTATAGAGCCTCCAATAAATTTCATTG
TGTCATCTCATTCTAAAGGAAAGAAAAGGCCGAGGTGGGCTCTTATTGAC
AAAGCATACATGCATAGCACATGGAGGTCGTCACAAGCATCATATCATCT
GTTTCGGACGAGTGGGAACTTTTCTCCTTCAGAAGATGCAATTCTTCTAA
TGGAAGATCTACTGAACCTCTCTTTGCATAGCTATGAGACTGTTCGCGCA
CTTGCTGGAAAATCACTGCTGAAGATGATTAAGAGATGGCCATCTATGAT
CTCAGAGTGTGTGCTCTCTCTTACTGAAAACTTGCGGAACCCTAAAGCAC
CTGAGAATGCAGTGCTAGGTTCTTGTGCAGTCCTTTCTACACAGACAGTT
CTTAAGCATTTGACAACGGATCCAAAAGCATTATCATCCTTTCTTCTTGG
AATTCTTTCTAGTTCCCACCATGAATCACTGAAAGCCCTGAAAGCAATTA
ATGAGCTTTTTGTCAAGTACAACATCCACTTCTCTGGAGTATCTAGAGCC
GTTTTCAGGGCATCGGACAATCACACAGATGGTTCAGATTTTGCAGATTT
GGTTTCTCAGATTATATCTATGAGTTTTGACTCTACTGGATTGCATTGGC
GGTATAACCTGATGGCTAATAGGGTTCTGCTTTTGTTGGCCATGACATCT
AGAAATGAGCCAAGCTTCTCTTCAAAAATACTGAGTGAAACTGCTGGTCA
CTTCCTAAAAAGTTTAAAGAGTCAACTTCCTCAGACAAGAATACTTGCAA
TCTCAGCTCTGAATACTCTTCTAAAAGAATCGCCATATAAGTTGGAAGCT
ATAGGGGTCACCCTGTCCATATTGTGCTCCAATATTCGCCTTCATTTATC
AATTGCTCATAATCATTCAAGTGAAGATGCAAATGCTGACTTTGATAAAC
TACTAAAAGAGGAAAATTGGGTTCTGTTTCTGACAGAACGAGCTTCTGAT
GTGGTCACAAATATTCAGAAAACTAGCCCTTTGGACAATTTAGAGATACC
AACACGGACAGTTCCTCAAAATGGGTCCTTGAATGGAGATGCACAGGATG
ATGTTAAGTGGATGGAAACGCTCTTTCATTTTGTCATATCAACACTGAAA
TCTGGAAGATCATCTTATTTGCTGGATGTCATTGTGCAGTTTCTCTATCC
AGTAATTTCCTTGCAGGAAACATCAAATAAAGACTTATCAACCCTGGCCA
AGGCTGCTTTCGAATTGCTAAAATGGAGGATTTTCTGGGAACCTCATCTT
CAAAGTGTTGTTTCAGTTATCCTTACTTCAGCCAATGATCCTAACTGGCG
GACCAGATCAGCTACTCTGACATATCTACGTACTTTCATGTATAGGCATA
CTTCTATTCTCTCGAGGATTGAGAAACAACAAATTTGGAGTACTGTTGAG
AATTTACTGAGGGACAATCAAGTAGAGGTGAGAGAGCATGCTGCGGCAGT
TCTAGCAGGTCTAATGAAGGGCGGGGATGAAGATCTTGCTAAAGACTTCC
GTGATAGAGCTTTCATAGTGGCCAGTACCATTCAAAGGAAGAGAAAGATG
AGGAATTCAAAATCTGGACAATCAATAGCATCTATTCATGGTGCTGTGCT
TGCTTTGGCTGCTTCTGTATTATCCGTCCCATATGATATGCCCGGGTATG
TTTAG
back to top