Manes.01G000400.3.v6.1 (mRNA)

Overview
NameManes.01G000400.3
Unique NameManes.01G000400.3.v6.1
TypemRNA
OrganismManihot esculenta (Cassava)
Sequence length2951
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chromosome01chromosomeChromosome01:83917..86867 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Manihot esculenta (JGI)2015-07-22
Properties
Property NameValue
Pacid32359323
Longest0
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
Manes.01G000400Manes.01G000400.v6.1Manihot esculentagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G000400.3Manes.01G000400.3.v6.1-proteinManihot esculentapolypeptide


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G000400.3.v6.1.CDS.5Manes.01G000400.3.v6.1.CDS.5Manihot esculentaCDS
Manes.01G000400.3.v6.1.CDS.4Manes.01G000400.3.v6.1.CDS.4Manihot esculentaCDS
Manes.01G000400.3.v6.1.CDS.3Manes.01G000400.3.v6.1.CDS.3Manihot esculentaCDS
Manes.01G000400.3.v6.1.CDS.2Manes.01G000400.3.v6.1.CDS.2Manihot esculentaCDS
Manes.01G000400.3.v6.1.CDS.1Manes.01G000400.3.v6.1.CDS.1Manihot esculentaCDS


The following three_prime_UTR feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G000400.3.v6.1.three_prime_UTR.1Manes.01G000400.3.v6.1.three_prime_UTR.1Manihot esculentathree_prime_UTR


The following five_prime_UTR feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G000400.3.v6.1.five_prime_UTR.1Manes.01G000400.3.v6.1.five_prime_UTR.1Manihot esculentafive_prime_UTR


Sequences
The following sequences are available for this feature:

mRNA sequence

>Manes.01G000400.3.v6.1 ID=Manes.01G000400.3.v6.1|Name=Manes.01G000400.3|organism=Manihot esculenta|type=mRNA|length=2951bp
CACAGTAAGAAAAAAAAAATATTAGCATTCGATAAATAAGGTACAGGGCT
TCGGCAAAACTATCCTTTCTCTCGTTTCAAGAAGTATATACTATTGAACA
AAATTTGATTGAAGCTAGAGAAAATGAATGGTTCCAAGAAATAGAAAGAG
ACCTACTACTACTGTTGTTTTTGAGAAGCAACGCCAGTCCAGTAACTTTT
GACTGCGACAAGAATTTTCTCAGGATTAAATGGTCCACTTTCGTGGTCCA
TTATCTGGCTTTTCCATTTCATCCCATTTGTTATGCCCTGTATCTTCACA
AGGATTTCTACATTGTCCCTAAATATAACTGTCCCTTCCGGCCTTAGAAT
TCTGTCCATCTCCAGCAAGATATATGAGATGTCGCACCTTCAAATGCACA
AACAAGGCACACGTTGAATCACAAAGGCATAAAATAAACCTCAATTTTTG
TATATTTTTAATTTCCAAACAGGGGAAAAGTGGTCGTTTTCATAATTAGT
TCAAGTATTAGTATAATTACCTGTCCTGATATATGCTGAAAACTCCACTG
GCATGTATGAGATCATATGTTCTTGGATATGTCGACATTGCCTCACACCA
ATCCTGATATGTCCCAATCAACCCTCGTTCGAATATAACACCAAGTGTGT
CTCGATCCGAATTGGCAGGTACAACGTTCATAACCCACACGGGATATTTC
AACAGTGCAGCCGCAAATCCACCGAGGTAAGCATTCATGTCCATTACATT
CCGATATCGCCCATGGCTCAGGGGGTTGATCATATGCTTATAATGCGTCA
CTCTTTCCTTCCACAGCTCATTATCCTGCTTGAATTTCTCTTCAGTGATG
CCTGGTATGGAGCCGCTGCGAATTCTGGGAGGTATCGCAAATGCACGCTC
TGGCCATTTCTCCAGTGCACCACCAGCAATTTCATCATTGCTGCTCACCT
CTGGTAGCGGGGTTATGCAAGCTTTCATGTTCTTGTACCTTTTTGGTTTA
TTTATTTTTAAGAGCACACGTTATGCACAAGGCAATAAGAGTTAAAGCAA
AGATCTTTATTAATTAATAGGATGATAGTATGAATTTAGAGAGTACCATG
CAGCATCTGGGTTGTCTGATTTGCATATGTGTGGTGTTTTATAAACCTTC
CTGCTTCTAATGCACTCCTTGTGATTGATGGGCTTTTGCCAAACTGCGAG
ATCATTCTTTTCAATCACTTTCTTCCAGCACAACCGCCTGGCTAAATTCT
CGAGAGCGTCCTGTTCTTGCTTCAAATCTTTTTTGGTTCTTTCCCAACCT
CTCCAGTAGCTCTTCCAGTTAATCGGAGGTCCAGACAGAATCCAATAACC
ACCAGGCCTCAAGACTCTGTCCACTTCAATTAGATATAAACCATCTGTAA
AATGCAAGGACAAAGGAAGTTCTCAGATGGAGAAGGCTTTTCTTCTACCT
CAAACGATAGTGTTTTTGCATAAATTTACCCCCTGAATGGTTAGTTCCAT
GAAGACCTTACCATAGTCGTTCCAAGGTACCAAGCAACGGGAACAGTGAG
CCATATCAAAAGCCCTTGCTGGGAAAGGAAGCCTTTCCGAAGCCAGGATG
CCAATCATAGCAGGAACTCCTCTCTCCAATGCAAACTGGACCTGGGCTTC
ATGTGTATCCCTTGGTGCAAAAGACATAGTCAAAATGTCCCGTTTCAACA
GGTAGGCACCCCAACTTGCGACCTTGACACCCACAGAAAATTCAGAAACA
GCGTATGCTAATGTTGAGAAGTTACTAAATTCTTAAACCATCATGGTAAT
TTTTATAAATATCAGGGAGGAACACTCACACCACAGCCTGTGTCAATTGC
AGTTCTGATGGTTCCACCAGTAAGAGGAATAAGCTCATTTATATCATCTA
TGTATGCATCAGCTCCAAGAGGGAACGAGGTGCCTCCACCAGGGAATCTG
AAGCGATTACCCTCTAATTGAATCCAATTCTGCACGGCCTTCTCAATACT
TAGTTCTCTGTGTGGGATATTGTCATACCAGGCATAGTCACGGCTCTGAG
GCCATGTGAAGGGAGTCTTATATTTTGGGGGAGCAGGAATCAGGCAAAAA
AGAAGTTCTTCCTTTGTAGGGCAATGCCTCTCCCTGTATTTCATCATGTC
CCTCGAGAATTTTCTTCCCCTTTGTGGATGTTGACAGGGAGTGTACTCAC
TGTAGGACATATCACATGGTTGAAAATTAGCAACCGAGTCAGTATTGTTT
ATCTCAATCTGATGGTGGCTATTGAAGTCTAAGGCAACAGATGAGGATGA
TGATGATGACGATAATGATGATGATGGATTATTAACTGCTGCTCCAGGGC
TTGCAACTTCACAACCTACTCTACTATACATCTCAGATCGACTGGTGGGA
GGAGCGCTATTCTGCCAAGCTCCCAAAGCGTAAAAAACTACGCAGAGGCC
GCTGATGCCCAAGATCCAAGTTAGACGTTTCCTCTTGGATTCAAGCTGAT
GTTGCTTTGGGGATCCAACGTAGTCCTTCGCCATTTTTATCTGTAACAGA
ACTCCCTGCAAAATTTCTCAACCCCAAGAATAAATAATTAGATAAGATAA
CACATCCCGTCATTTCTATAAAGCTGCCTTCCGACCTGATCAAAACAAGC
ATTGCGCACAAAGATTACTATTTTTCCACCACTACTCATACTTAGTTTAA
TTATTGTGAAAAAATTATAAAGGGTTTGCAGAAAATCTGGCAGAAAACTA
TGCCCACGTGTCATTAAGGAAACCAAAGACTAGCAAATTGATGAATTTAG
TTAAAATGCAGATATAATGAAGAACTCAAAGGCTATATGTCAGAGAATTG
CATCAGAAAGGAGAAGAAAAAGGTTGAAGAGGGATTGGAAGTGTGAAGAG
AAGCTGAATATTAACATGCTGAGAAAAATAAATCCTAATATAAAAACTGC
A
back to top

mRNA from alignment at Chromosome01:83917..86867-

Legend: five_prime_UTRCDSthree_prime_UTR
Hold the cursor over a type above to highlight its positions in the sequence below.
>Manes.01G000400.3.v6.1 ID=Manes.01G000400.3.v6.1|Name=Manes.01G000400.3|organism=Manihot esculenta|type=mRNA|length=2951bp|location=Sequence derived from alignment at Chromosome01:83917..86867- (Manihot esculenta)
TGCAGTTTTTATATTAGGATTTATTTTTCTCAGCATGTTAATATTCAGCT TCTCTTCACACTTCCAATCCCTCTTCAACCTTTTTCTTCTCCTTTCTGAT GCAATTCTCTGACATATAGCCTTTGAGTTCTTCATTATATCTGCATTTTA ACTAAATTCATCAATTTGCTAGTCTTTGGTTTCCTTAATGACACGTGGGC ATAGTTTTCTGCCAGATTTTCTGCAAACCCTTTATAATTTTTTCACAATA ATTAAACTAAGTATGAGTAGTGGTGGAAAAATAGTAATCTTTGTGCGCAA TGCTTGTTTTGATCAGGTCGGAAGGCAGCTTTATAGAAATGACGGGATGT GTTATCTTATCTAATTATTTATTCTTGGGGTTGAGAAATTTTGCAGGGAG TTCTGTTACAGATAAAAATGGCGAAGGACTACGTTGGATCCCCAAAGCAA CATCAGCTTGAATCCAAGAGGAAACGTCTAACTTGGATCTTGGGCATCAG CGGCCTCTGCGTAGTTTTTTACGCTTTGGGAGCTTGGCAGAATAGCGCTC CTCCCACCAGTCGATCTGAGATGTATAGTAGAGTAGGTTGTGAAGTTGCA AGCCCTGGAGCAGCAGTTAATAATCCATCATCATCATTATCGTCATCATC ATCATCCTCATCTGTTGCCTTAGACTTCAATAGCCACCATCAGATTGAGA TAAACAATACTGACTCGGTTGCTAATTTTCAACCATGTGATATGTCCTAC AGTGAGTACACTCCCTGTCAACATCCACAAAGGGGAAGAAAATTCTCGAG GGACATGATGAAATACAGGGAGAGGCATTGCCCTACAAAGGAAGAACTTC TTTTTTGCCTGATTCCTGCTCCCCCAAAATATAAGACTCCCTTCACATGG CCTCAGAGCCGTGACTATGCCTGGTATGACAATATCCCACACAGAGAACT AAGTATTGAGAAGGCCGTGCAGAATTGGATTCAATTAGAGGGTAATCGCT TCAGATTCCCTGGTGGAGGCACCTCGTTCCCTCTTGGAGCTGATGCATAC ATAGATGATATAAATGAGCTTATTCCTCTTACTGGTGGAACCATCAGAAC TGCAATTGACACAGGCTGTGGTGTGAGTGTTCCTCCCTGATATTTATAAA AATTACCATGATGGTTTAAGAATTTAGTAACTTCTCAACATTAGCATACG CTGTTTCTGAATTTTCTGTGGGTGTCAAGGTCGCAAGTTGGGGTGCCTAC CTGTTGAAACGGGACATTTTGACTATGTCTTTTGCACCAAGGGATACACA TGAAGCCCAGGTCCAGTTTGCATTGGAGAGAGGAGTTCCTGCTATGATTG GCATCCTGGCTTCGGAAAGGCTTCCTTTCCCAGCAAGGGCTTTTGATATG GCTCACTGTTCCCGTTGCTTGGTACCTTGGAACGACTATGGTAAGGTCTT CATGGAACTAACCATTCAGGGGGTAAATTTATGCAAAAACACTATCGTTT GAGGTAGAAGAAAAGCCTTCTCCATCTGAGAACTTCCTTTGTCCTTGCAT TTTACAGATGGTTTATATCTAATTGAAGTGGACAGAGTCTTGAGGCCTGG TGGTTATTGGATTCTGTCTGGACCTCCGATTAACTGGAAGAGCTACTGGA GAGGTTGGGAAAGAACCAAAAAAGATTTGAAGCAAGAACAGGACGCTCTC GAGAATTTAGCCAGGCGGTTGTGCTGGAAGAAAGTGATTGAAAAGAATGA TCTCGCAGTTTGGCAAAAGCCCATCAATCACAAGGAGTGCATTAGAAGCA GGAAGGTTTATAAAACACCACACATATGCAAATCAGACAACCCAGATGCT GCATGGTACTCTCTAAATTCATACTATCATCCTATTAATTAATAAAGATC TTTGCTTTAACTCTTATTGCCTTGTGCATAACGTGTGCTCTTAAAAATAA ATAAACCAAAAAGGTACAAGAACATGAAAGCTTGCATAACCCCGCTACCA GAGGTGAGCAGCAATGATGAAATTGCTGGTGGTGCACTGGAGAAATGGCC AGAGCGTGCATTTGCGATACCTCCCAGAATTCGCAGCGGCTCCATACCAG GCATCACTGAAGAGAAATTCAAGCAGGATAATGAGCTGTGGAAGGAAAGA GTGACGCATTATAAGCATATGATCAACCCCCTGAGCCATGGGCGATATCG GAATGTAATGGACATGAATGCTTACCTCGGTGGATTTGCGGCTGCACTGT TGAAATATCCCGTGTGGGTTATGAACGTTGTACCTGCCAATTCGGATCGA GACACACTTGGTGTTATATTCGAACGAGGGTTGATTGGGACATATCAGGA TTGGTGTGAGGCAATGTCGACATATCCAAGAACATATGATCTCATACATG CCAGTGGAGTTTTCAGCATATATCAGGACAGGTAATTATACTAATACTTG AACTAATTATGAAAACGACCACTTTTCCCCTGTTTGGAAATTAAAAATAT ACAAAAATTGAGGTTTATTTTATGCCTTTGTGATTCAACGTGTGCCTTGT TTGTGCATTTGAAGGTGCGACATCTCATATATCTTGCTGGAGATGGACAG AATTCTAAGGCCGGAAGGGACAGTTATATTTAGGGACAATGTAGAAATCC TTGTGAAGATACAGGGCATAACAAATGGGATGAAATGGAAAAGCCAGATA ATGGACCACGAAAGTGGACCATTTAATCCTGAGAAAATTCTTGTCGCAGT CAAAAGTTACTGGACTGGCGTTGCTTCTCAAAAACAACAGTAGTAGTAGG TCTCTTTCTATTTCTTGGAACCATTCATTTTCTCTAGCTTCAATCAAATT TTGTTCAATAGTATATACTTCTTGAAACGAGAGAAAGGATAGTTTTGCCG AAGCCCTGTACCTTATTTATCGAATGCTAATATTTTTTTTTTCTTACTGT G
back to top

Coding sequence (CDS) from alignment at Chromosome01:83917..86867-

>Manes.01G000400.3.v6.1 ID=Manes.01G000400.3.v6.1|Name=Manes.01G000400.3|organism=Manihot esculenta|type=CDS|length=1911bp|location=Sequence derived from alignment at Chromosome01:83917..86867- (Manihot esculenta)
ATGGCGAAGGACTACGTTGGATCCCCAAAGCAACATCAGCTTGAATCCAA
GAGGAAACGTCTAACTTGGATCTTGGGCATCAGCGGCCTCTGCGTAGTTT
TTTACGCTTTGGGAGCTTGGCAGAATAGCGCTCCTCCCACCAGTCGATCT
GAGATGTATAGTAGAGTAGGTTGTGAAGTTGCAAGCCCTGGAGCAGCAGT
TAATAATCCATCATCATCATTATCGTCATCATCATCATCCTCATCTGTTG
CCTTAGACTTCAATAGCCACCATCAGATTGAGATAAACAATACTGACTCG
GTTGCTAATTTTCAACCATGTGATATGTCCTACAGTGAGTACACTCCCTG
TCAACATCCACAAAGGGGAAGAAAATTCTCGAGGGACATGATGAAATACA
GGGAGAGGCATTGCCCTACAAAGGAAGAACTTCTTTTTTGCCTGATTCCT
GCTCCCCCAAAATATAAGACTCCCTTCACATGGCCTCAGAGCCGTGACTA
TGCCTGGTATGACAATATCCCACACAGAGAACTAAGTATTGAGAAGGCCG
TGCAGAATTGGATTCAATTAGAGGGTAATCGCTTCAGATTCCCTGGTGGA
GGCACCTCGTTCCCTCTTGGAGCTGATGCATACATAGATGATATAAATGA
GCTTATTCCTCTTACTGGTGGAACCATCAGAACTGCAATTGACACAGGCT
GTGGTGTCGCAAGTTGGGGTGCCTACCTGTTGAAACGGGACATTTTGACT
ATGTCTTTTGCACCAAGGGATACACATGAAGCCCAGGTCCAGTTTGCATT
GGAGAGAGGAGTTCCTGCTATGATTGGCATCCTGGCTTCGGAAAGGCTTC
CTTTCCCAGCAAGGGCTTTTGATATGGCTCACTGTTCCCGTTGCTTGGTA
CCTTGGAACGACTATGATGGTTTATATCTAATTGAAGTGGACAGAGTCTT
GAGGCCTGGTGGTTATTGGATTCTGTCTGGACCTCCGATTAACTGGAAGA
GCTACTGGAGAGGTTGGGAAAGAACCAAAAAAGATTTGAAGCAAGAACAG
GACGCTCTCGAGAATTTAGCCAGGCGGTTGTGCTGGAAGAAAGTGATTGA
AAAGAATGATCTCGCAGTTTGGCAAAAGCCCATCAATCACAAGGAGTGCA
TTAGAAGCAGGAAGGTTTATAAAACACCACACATATGCAAATCAGACAAC
CCAGATGCTGCATGGTACAAGAACATGAAAGCTTGCATAACCCCGCTACC
AGAGGTGAGCAGCAATGATGAAATTGCTGGTGGTGCACTGGAGAAATGGC
CAGAGCGTGCATTTGCGATACCTCCCAGAATTCGCAGCGGCTCCATACCA
GGCATCACTGAAGAGAAATTCAAGCAGGATAATGAGCTGTGGAAGGAAAG
AGTGACGCATTATAAGCATATGATCAACCCCCTGAGCCATGGGCGATATC
GGAATGTAATGGACATGAATGCTTACCTCGGTGGATTTGCGGCTGCACTG
TTGAAATATCCCGTGTGGGTTATGAACGTTGTACCTGCCAATTCGGATCG
AGACACACTTGGTGTTATATTCGAACGAGGGTTGATTGGGACATATCAGG
ATTGGTGTGAGGCAATGTCGACATATCCAAGAACATATGATCTCATACAT
GCCAGTGGAGTTTTCAGCATATATCAGGACAGGTGCGACATCTCATATAT
CTTGCTGGAGATGGACAGAATTCTAAGGCCGGAAGGGACAGTTATATTTA
GGGACAATGTAGAAATCCTTGTGAAGATACAGGGCATAACAAATGGGATG
AAATGGAAAAGCCAGATAATGGACCACGAAAGTGGACCATTTAATCCTGA
GAAAATTCTTGTCGCAGTCAAAAGTTACTGGACTGGCGTTGCTTCTCAAA
AACAACAGTAG
back to top