Manes.01G000100.1.v6.1 (mRNA)

Overview
NameManes.01G000100.1
Unique NameManes.01G000100.1.v6.1
TypemRNA
OrganismManihot esculenta (Cassava)
Sequence length800
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chromosome01chromosomeChromosome01:4..803 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Manihot esculenta (JGI)2015-07-22
Properties
Property NameValue
Pacid32359689
Longest1
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
Manes.01G000100Manes.01G000100.v6.1Manihot esculentagene


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G000100.1Manes.01G000100.1.v6.1-proteinManihot esculentapolypeptide


The following five_prime_UTR feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G000100.1.v6.1.five_prime_UTR.1Manes.01G000100.1.v6.1.five_prime_UTR.1Manihot esculentafive_prime_UTR


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G000100.1.v6.1.CDS.1Manes.01G000100.1.v6.1.CDS.1Manihot esculentaCDS


The following three_prime_UTR feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
Manes.01G000100.1.v6.1.three_prime_UTR.1Manes.01G000100.1.v6.1.three_prime_UTR.1Manihot esculentathree_prime_UTR


Sequences
The following sequences are available for this feature:

mRNA sequence

>Manes.01G000100.1.v6.1 ID=Manes.01G000100.1.v6.1|Name=Manes.01G000100.1|organism=Manihot esculenta|type=mRNA|length=800bp
CAGAGAAAGTCCAAGCAATCATGAACCATATAAATGTGAATTTTAGCTCC
TACCTTTTCACATAGCAGTTATTTCTTTTCCATTTCCTTGCCAAAACAAA
AATTTTACAGTCCAAACCATATTTTATTTTTTGTGGTCCACATGGTCAAT
GTCTTCTCTGTAAATCCAAGCCAGCATCTAAAAAGAAACTTGCGAATTTT
TTCTTCAATGATTAGACACAAAGCTCCAAAGGAACTCAAAATCCAAACCA
CCACCCAATCCATTGATCACCACATGCACTTCACTCCACCATTGAACCAC
TGCTTATCTGCAAGCCATACTCCTCTAAATAATTCACACAACAGATGTGG
AGAACCTAATTAAAATTTGAATGGATTGGCTGAGTACAACTAAAAAATGA
AGGGCTTATTTGACTATCAAATTAAAATTAAGGGGTCAATTTGGCATTTT
GCCTTTTTTACTCAATAAAAATCTATTTTTTTAATTTTTTAACACCATCA
ATTAATGATGGTAATTTTGGATTTGCCCAAAAATATTTGACTATTAATTT
TTGTCAAGGACTAATATTACTATTGTCCATTAATTAAAGACCAAACATGA
GACACTTGGCTATATTTCAGATATTATAGGACAAAGTATAAGTGCAAGTC
AAAGTTATAGAAGTTGGCTGATAGCAGTTAGTTTCAGTAGTTATAACTGC
CCTCTCTTAGTGGGAATGGGAAAATAAATAGAGCTGTATAAGGTCCTGAA
TTGTTCATTCAAGAACTGAAGTCAATGATAACAATCTCTCTCTCTCTCTC
back to top

mRNA from alignment at Chromosome01:4..803+

Legend: five_prime_UTRCDSthree_prime_UTR
Hold the cursor over a type above to highlight its positions in the sequence below.
>Manes.01G000100.1.v6.1 ID=Manes.01G000100.1.v6.1|Name=Manes.01G000100.1|organism=Manihot esculenta|type=mRNA|length=800bp|location=Sequence derived from alignment at Chromosome01:4..803+ (Manihot esculenta)
CAGAGAAAGTCCAAGCAATCATGAACCATATAAATGTGAATTTTAGCTCC TACCTTTTCACATAGCAGTTATTTCTTTTCCATTTCCTTGCCAAAACAAA AATTTTACAGTCCAAACCATATTTTATTTTTTGTGGTCCACATGGTCAAT GTCTTCTCTGTAAATCCAAGCCAGCATCTAAAAAGAAACTTGCGAATTTT TTCTTCAATGATTAGACACAAAGCTCCAAAGGAACTCAAAATCCAAACCA CCACCCAATCCATTGATCACCACATGCACTTCACTCCACCATTGAACCAC TGCTTATCTGCAAGCCATACTCCTCTAAATAATTCACACAACAGATGTGG AGAACCTAATTAAAATTTGAATGGATTGGCTGAGTACAACTAAAAAATGA AGGGCTTATTTGACTATCAAATTAAAATTAAGGGGTCAATTTGGCATTTT GCCTTTTTTACTCAATAAAAATCTATTTTTTTAATTTTTTAACACCATCA ATTAATGATGGTAATTTTGGATTTGCCCAAAAATATTTGACTATTAATTT TTGTCAAGGACTAATATTACTATTGTCCATTAATTAAAGACCAAACATGA GACACTTGGCTATATTTCAGATATTATAGGACAAAGTATAAGTGCAAGTC AAAGTTATAGAAGTTGGCTGATAGCAGTTAGTTTCAGTAGTTATAACTGC CCTCTCTTAGTGGGAATGGGAAAATAAATAGAGCTGTATAAGGTCCTGAA TTGTTCATTCAAGAACTGAAGTCAATGATAACAATCTCTCTCTCTCTCTC
back to top

Coding sequence (CDS) from alignment at Chromosome01:4..803+

>Manes.01G000100.1.v6.1 ID=Manes.01G000100.1.v6.1|Name=Manes.01G000100.1|organism=Manihot esculenta|type=CDS|length=222bp|location=Sequence derived from alignment at Chromosome01:4..803+ (Manihot esculenta)
ATGGTCAATGTCTTCTCTGTAAATCCAAGCCAGCATCTAAAAAGAAACTT
GCGAATTTTTTCTTCAATGATTAGACACAAAGCTCCAAAGGAACTCAAAA
TCCAAACCACCACCCAATCCATTGATCACCACATGCACTTCACTCCACCA
TTGAACCACTGCTTATCTGCAAGCCATACTCCTCTAAATAATTCACACAA
CAGATGTGGAGAACCTAATTAA
back to top