Manes.01G014200.v6.1 (gene)

Overview
NameManes.01G014200
Unique NameManes.01G014200.v6.1
Typegene
OrganismManihot esculenta (Cassava)
Sequence length1815
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chromosome01chromosomeChromosome01:2402903..2404717 +
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Manihot esculenta (JGI)2015-07-22
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Manes.01G014200.1Manes.01G014200.1.v6.1Manihot esculentamRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Manes.01G014200.v6.1 ID=Manes.01G014200.v6.1|Name=Manes.01G014200|organism=Manihot esculenta|type=gene|length=1815bp
GACCCATAGCCGTAGTGCTTACTGCTTATCGACCTAAATTTTGGCATAAC
TCATGTTCACAAGTTTGACTTGACCTTTGTTTGTGCATTGCTTAACCAAC
GTTGATTATTCGGTCTGAACCCTCTAGCCCCTATTTTCACTAATCAATTG
TCTGAAACCATGTTCTTCTTCCAAGTCCTACACAAGAACTTTCAAATTCT
GGACCAAGATTGCCATTACACATGCACAAGTGATTTTGTCTTTGTGGGCT
AATTTAGCTTCCATTAATATCCCATTTCTTCAACAAACCTCTTGCTCTGG
CCTTGGAGACAATGAGAAATTGGCACAAAAATTGTCCAATATCAGTTGCC
AATGCCAAGCTTATTAGTTCCTTTTTGCAGTTGGGCTATTTATTTCGTTT
TCTCTTCTTTCTCGTTGGTTTGTCACTTGGCTTCACTGTCTGCGTGTATT
TGAAAAGCATCTCCTTTGATTTCTACGCTACTTTGTTCTCTCTTTCACCA
TCCCCACCAACACAACTGCCGCCGCCTCCTCCTCCTCCTAGTAATATGAG
TAGCTTATTCATATCAAGAACTAAACTTCCTGTTAGTCTTATGCATAATA
TGGAAGATGATGAGTTGTTTTGGCGAGCGTCTATGGTTCCGAGGATTCGG
AGGATTCCTCAAAAACTTGTTCCTAAGTCTAAAGTTGCTTTCATGTTCTT
GACGAAGGGAGCTTTGCCTTTGGCTTCGTTGTGGGAAGAGTTTTTTAAAG
GACATGAAGGGCTTTACAATATATATGTTCATCCTCATCCCTCTTTCAAC
TATACTTTCCCGGAAACCTCTGTTTTCCATGAAAGGAGAATTCCAAGCAA
GGTCAGTTTTTTCTGTGTCTTTCGATTATTTCAACATAAGCAAATCCTAC
ATCCAGAAAAGATTAACAAAAATAAAAAAAATAATAATAAAATTTATTTA
ATTATTTTCAAATTTGTACTAACATATTTGAAATTATTAAAAATAATTAA
AAATTTAAAGTTATGTAGCATATTCGAATCATAAATTTTTTCATTTATTT
ATTTATTTATTTATATTAATTGCAGCCTGTGGAATGGGGAAGAGCATCCA
TGATTGACGCAGAGAGGAGACTTTTAGCGAACGCACTCCTTGACTTATCA
AACGACAGATTTGTACTTATCTCAGAAACATGCATTCCTTTATTCAACTT
CTCAACAACATACAACTACCTCATCAATGCTCGAAAAAGCTTCGTGGGTT
CCTACGACGATCCAAGAAAAGTGGGTCGGGGCCGATACAATCCGAAAATG
TCTCCAACAATCACAATTTCTAACTGGCGTAAAGGGTCTCAGTGGTTTGA
AGTTAATCGCAAGGTGGCCATTGAAATAGTTTCAGACACAACGTATTATC
CAGTTTTTCGACAGCATTGTAGCCCTCCATGTTACGTGGACGAGCATTAT
ATTCCTACACTTGTTAACATTGTTTGTCCAGAGGAAAATAACAACAGGAG
CATTACTTGGGTTGATTGGTCGAAGAGTGGTCCTCATCCTGGAAAATTTG
GGAAGAAATCTGTTTCCGTTGAGTTCTTGGATCGAATTAGGTTTCGTGGT
AATTGTTCTTACAATGGGAATGCTTCCTCTGTCTGCTTCCTGTTTGCTAG
GAAGTTCTTGCCTGATACTTTGGAGATTTTGTTGCAGATTGCACCAGGGC
TGCCACATTTCAATCATTCTTATTCAGCTTCTTCTACCAATGTATAGTAT
TTATTTGAATTTGATTCTAATTGATGTTTGAATTCAAAATTAACTAATTA
ATTTCTTCCAAATTC
back to top

gene from alignment at Chromosome01:2402903..2404717+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Manes.01G014200.v6.1 ID=Manes.01G014200.v6.1|Name=Manes.01G014200|organism=Manihot esculenta|type=gene|length=1815bp|location=Sequence derived from alignment at Chromosome01:2402903..2404717+ (Manihot esculenta)
GACCCATAGCCGTAGTGCTTACTGCTTATCGACCTAAATTTTGGCATAAC TCATGTTCACAAGTTTGACTTGACCTTTGTTTGTGCATTGCTTAACCAAC GTTGATTATTCGGTCTGAACCCTCTAGCCCCTATTTTCACTAATCAATTG TCTGAAACCATGTTCTTCTTCCAAGTCCTACACAAGAACTTTCAAATTCT GGACCAAGATTGCCATTACACATGCACAAGTGATTTTGTCTTTGTGGGCT AATTTAGCTTCCATTAATATCCCATTTCTTCAACAAACCTCTTGCTCTGG CCTTGGAGACAATGAGAAATTGGCACAAAAATTGTCCAATATCAGTTGCC AATGCCAAGCTTATTAGTTCCTTTTTGCAGTTGGGCTATTTATTTCGTTT TCTCTTCTTTCTCGTTGGTTTGTCACTTGGCTTCACTGTCTGCGTGTATT TGAAAAGCATCTCCTTTGATTTCTACGCTACTTTGTTCTCTCTTTCACCA TCCCCACCAACACAACTGCCGCCGCCTCCTCCTCCTCCTAGTAATATGAG TAGCTTATTCATATCAAGAACTAAACTTCCTGTTAGTCTTATGCATAATA TGGAAGATGATGAGTTGTTTTGGCGAGCGTCTATGGTTCCGAGGATTCGG AGGATTCCTCAAAAACTTGTTCCTAAGTCTAAAGTTGCTTTCATGTTCTT GACGAAGGGAGCTTTGCCTTTGGCTTCGTTGTGGGAAGAGTTTTTTAAAG GACATGAAGGGCTTTACAATATATATGTTCATCCTCATCCCTCTTTCAAC TATACTTTCCCGGAAACCTCTGTTTTCCATGAAAGGAGAATTCCAAGCAA GGTCAGTTTTTTCTGTGTCTTTCGATTATTTCAACATAAGCAAATCCTAC ATCCAGAAAAGATTAACAAAAATAAAAAAAATAATAATAAAATTTATTTA ATTATTTTCAAATTTGTACTAACATATTTGAAATTATTAAAAATAATTAA AAATTTAAAGTTATGTAGCATATTCGAATCATAAATTTTTTCATTTATTT ATTTATTTATTTATATTAATTGCAGCCTGTGGAATGGGGAAGAGCATCCA TGATTGACGCAGAGAGGAGACTTTTAGCGAACGCACTCCTTGACTTATCA AACGACAGATTTGTACTTATCTCAGAAACATGCATTCCTTTATTCAACTT CTCAACAACATACAACTACCTCATCAATGCTCGAAAAAGCTTCGTGGGTT CCTACGACGATCCAAGAAAAGTGGGTCGGGGCCGATACAATCCGAAAATG TCTCCAACAATCACAATTTCTAACTGGCGTAAAGGGTCTCAGTGGTTTGA AGTTAATCGCAAGGTGGCCATTGAAATAGTTTCAGACACAACGTATTATC CAGTTTTTCGACAGCATTGTAGCCCTCCATGTTACGTGGACGAGCATTAT ATTCCTACACTTGTTAACATTGTTTGTCCAGAGGAAAATAACAACAGGAG CATTACTTGGGTTGATTGGTCGAAGAGTGGTCCTCATCCTGGAAAATTTG GGAAGAAATCTGTTTCCGTTGAGTTCTTGGATCGAATTAGGTTTCGTGGT AATTGTTCTTACAATGGGAATGCTTCCTCTGTCTGCTTCCTGTTTGCTAG GAAGTTCTTGCCTGATACTTTGGAGATTTTGTTGCAGATTGCACCAGGGC TGCCACATTTCAATCATTCTTATTCAGCTTCTTCTACCAATGTATAGTAT TTATTTGAATTTGATTCTAATTGATGTTTGAATTCAAAATTAACTAATTA ATTTCTTCCAAATTC
back to top