Manes.01G002400.v6.1 (gene)

Overview
NameManes.01G002400
Unique NameManes.01G002400.v6.1
Typegene
OrganismManihot esculenta (Cassava)
Sequence length2404
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chromosome01chromosomeChromosome01:507026..509429 +
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Manihot esculenta (JGI)2015-07-22
Properties
Property NameValue
AncestorIdentifiercassava4.1_018417m.g.v4.1
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Manes.01G002400.1Manes.01G002400.1.v6.1Manihot esculentamRNA


Sequences
The following sequences are available for this feature:

gene sequence

>Manes.01G002400.v6.1 ID=Manes.01G002400.v6.1|Name=Manes.01G002400|organism=Manihot esculenta|type=gene|length=2404bp
AGGCGCCTATCAAAGAGCGCATCTATTATTATCATTTTCTCTTTTCTCTT
CCTCCTTTGATATTTTCTTCCTCCTTTCTCTCTCCCAACACATACCTCCA
AAAATGGCCGATCAGCTCACCGACGACCAGATCTCTGAGTTCAAGGAAGC
CTTCAGCCTTTTTGATAAGGATGGAGATGGTATTTCTTTCAAATCTCTCT
TAATCTTATCACGCCTTCGTTTTTTTCTTTATTTGTGCTTTCTGTTTTCT
TAGATTTACTTTTCTGTTCTATTTGTTGCTATTAATTTTATTATTTTTAA
GGCAATGAATTAGATAAAAGCTTATTTTTGCTGGCTCAGTAATTAACAAG
CTGACTTGAAGCATGATTTTGAAATTCGTTTAATTATGCGGTTTTAGACT
CGTTGAATATTGAGTTTGTTTAAAGTTGCGATCCGGTTAGTAAAGTTGTG
ATTCGGCTCGTTAATCCTTCATTTAGAAGCTTGTCAAAAGCTTGTTGGAA
TAAGTCAATTTATATTTTTGTTATCATTAATTTATGGTCATTATGTAATT
ATTAATTTAATTATATTGATTCATTTGACCTATTTAGATATATAATTATT
TTGATTTATTTGACCTATTTTGATTTATAATGAATAAATTAATTATAAAT
TTGTTCAGCAATTTGGTTGTTAAATTTAATAATGACTGGAGCTTATGCTT
TCAAGCTTGATAAACAAGCTAAATATGAGTCGAGTTTTTAATCTTGATAA
ATGAACAAACTATGAGCGAAGCCCTACAAGTTTGATAACTTAGCTACATG
ATAGGTGAGATTGAATTTAATAAAATTAATAGGAGGGTTATGGTGCTGTT
TATGTGGACTTCCATATCTTCTATCCTGATTGTTTTGATTTCATTTGTTG
AAGGATTTGATGGGCATGTTTTATTTTTGTTAAAAACTAGATTATTATGG
ATATGATTGATTTGGCTTGGATTGAGTAGACCATTTTATTTATGTTTTGT
GGAAATGATGGATTTTGAACTGGATGCCTGTTTCATCTAGCTGCCTGTGT
TTTAAGTGAGTGATGACAGTATGGGTATAATTTTGAGGAAATACTCGGGT
ATAACAAGTGTATGTGTATTTTATTTTTCATTTTTAGTTAAATTCACTGT
GCAGATGTATTTTATTGTAATATAAACTTTAGTTTTCTCGACAGCATATG
GCAGAAATGCTTGCATTGGATCCACTTAATATTGCATTTTCTTGTTGATT
TTTTAATAAATGATTATGCTCTGTGTATATACATGGTTTCTTGGGCTTCT
TGCTGTTAATGTCCAAGTTCTTGTTTCCTGTTTAATTTAGAGCTTATTTT
ATTTTTGTTATGAAGTTTTGACATTGATATGTCCAAGTTATTGTTTCCTG
TATAATTTAGATCTTCTTTTATTTTTGTTATGAATTTTTGACATTGATAT
GTATGGTCACTTCCCAATTCCTGTGTTGAAACGTTCATCTGGTTGAGTTT
TGGAGCATCACAAACTAGTTATTGTGGCGTTGTTTCATTAAAAACACAAA
GTTCCTGGTGATGTTTTGTTAGTCTATAGAATGTTGCCATAAAGACTTCT
GTTCCCATAATTTCACCAGATATGCTTGATTGCATGTATTGCTGACTGTG
TCTCTTGCAATGGTTTCTGTTTTTATTGCAGGCTGCATTACTACTAAAGA
ACTTGGGACTGTAATGCGTTCACTGGGCCAGAACCCAACTGAAGCAGAGC
TTCAGGACATGATAAATGAGGTTGATGCTGATGGGAATGGTACTATTGAT
TTCCCGGAGTTCCTTAATCTGATGGCTCGCAAGATGAAGGACACTGATTC
TGAGGAAGAGCTCAAGGAAGCTTTCCGGGTTTTTGATAAGGATCAGAATG
GCTTCATTTCTGCTGCTGAGCTCCGACATGTCATGACAAATCTTGGTGAG
AAGCTGACAGATGAGGAGGTTGATGAGATGATCCGAGAGGCGGATGTGGA
TGGTGATGGCCAGATCAACTATGAGGAGTTTGTCAAAGTCATGATGGCCA
AGTAAGGAGCAGTCAACCATAACTAGAAGTTAAAAAAACATAAGAAGAGA
GAAGGAACGGGGCAGATAAGTTTGATGAGAAAAATACTATTTCCCTTAGG
ACATCTTCATTTGGTGATATTAGCTTTGGTTGGATTGTCTGTTGGCTTGT
TTGCATTATTTTGTTGCACTTTCCATTACTATTTGCTCTGTTTCTTGTTA
GTAGCTTGGCTTGTTAGTTTCTTTCTTTTATTGTTTGTTATTTTATATCT
ACCTTTGGATTATGAACCTAGAACAATCTGGATGGATAATCATGTTTTGC
TTATGCATGACTAATTTTGTTAATATTCTAAAGTTTAGGCACTTCTATTT
TTAT
back to top

gene from alignment at Chromosome01:507026..509429+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Manes.01G002400.v6.1 ID=Manes.01G002400.v6.1|Name=Manes.01G002400|organism=Manihot esculenta|type=gene|length=2404bp|location=Sequence derived from alignment at Chromosome01:507026..509429+ (Manihot esculenta)
AGGCGCCTATCAAAGAGCGCATCTATTATTATCATTTTCTCTTTTCTCTT CCTCCTTTGATATTTTCTTCCTCCTTTCTCTCTCCCAACACATACCTCCA AAAATGGCCGATCAGCTCACCGACGACCAGATCTCTGAGTTCAAGGAAGC CTTCAGCCTTTTTGATAAGGATGGAGATGGTATTTCTTTCAAATCTCTCT TAATCTTATCACGCCTTCGTTTTTTTCTTTATTTGTGCTTTCTGTTTTCT TAGATTTACTTTTCTGTTCTATTTGTTGCTATTAATTTTATTATTTTTAA GGCAATGAATTAGATAAAAGCTTATTTTTGCTGGCTCAGTAATTAACAAG CTGACTTGAAGCATGATTTTGAAATTCGTTTAATTATGCGGTTTTAGACT CGTTGAATATTGAGTTTGTTTAAAGTTGCGATCCGGTTAGTAAAGTTGTG ATTCGGCTCGTTAATCCTTCATTTAGAAGCTTGTCAAAAGCTTGTTGGAA TAAGTCAATTTATATTTTTGTTATCATTAATTTATGGTCATTATGTAATT ATTAATTTAATTATATTGATTCATTTGACCTATTTAGATATATAATTATT TTGATTTATTTGACCTATTTTGATTTATAATGAATAAATTAATTATAAAT TTGTTCAGCAATTTGGTTGTTAAATTTAATAATGACTGGAGCTTATGCTT TCAAGCTTGATAAACAAGCTAAATATGAGTCGAGTTTTTAATCTTGATAA ATGAACAAACTATGAGCGAAGCCCTACAAGTTTGATAACTTAGCTACATG ATAGGTGAGATTGAATTTAATAAAATTAATAGGAGGGTTATGGTGCTGTT TATGTGGACTTCCATATCTTCTATCCTGATTGTTTTGATTTCATTTGTTG AAGGATTTGATGGGCATGTTTTATTTTTGTTAAAAACTAGATTATTATGG ATATGATTGATTTGGCTTGGATTGAGTAGACCATTTTATTTATGTTTTGT GGAAATGATGGATTTTGAACTGGATGCCTGTTTCATCTAGCTGCCTGTGT TTTAAGTGAGTGATGACAGTATGGGTATAATTTTGAGGAAATACTCGGGT ATAACAAGTGTATGTGTATTTTATTTTTCATTTTTAGTTAAATTCACTGT GCAGATGTATTTTATTGTAATATAAACTTTAGTTTTCTCGACAGCATATG GCAGAAATGCTTGCATTGGATCCACTTAATATTGCATTTTCTTGTTGATT TTTTAATAAATGATTATGCTCTGTGTATATACATGGTTTCTTGGGCTTCT TGCTGTTAATGTCCAAGTTCTTGTTTCCTGTTTAATTTAGAGCTTATTTT ATTTTTGTTATGAAGTTTTGACATTGATATGTCCAAGTTATTGTTTCCTG TATAATTTAGATCTTCTTTTATTTTTGTTATGAATTTTTGACATTGATAT GTATGGTCACTTCCCAATTCCTGTGTTGAAACGTTCATCTGGTTGAGTTT TGGAGCATCACAAACTAGTTATTGTGGCGTTGTTTCATTAAAAACACAAA GTTCCTGGTGATGTTTTGTTAGTCTATAGAATGTTGCCATAAAGACTTCT GTTCCCATAATTTCACCAGATATGCTTGATTGCATGTATTGCTGACTGTG TCTCTTGCAATGGTTTCTGTTTTTATTGCAGGCTGCATTACTACTAAAGA ACTTGGGACTGTAATGCGTTCACTGGGCCAGAACCCAACTGAAGCAGAGC TTCAGGACATGATAAATGAGGTTGATGCTGATGGGAATGGTACTATTGAT TTCCCGGAGTTCCTTAATCTGATGGCTCGCAAGATGAAGGACACTGATTC TGAGGAAGAGCTCAAGGAAGCTTTCCGGGTTTTTGATAAGGATCAGAATG GCTTCATTTCTGCTGCTGAGCTCCGACATGTCATGACAAATCTTGGTGAG AAGCTGACAGATGAGGAGGTTGATGAGATGATCCGAGAGGCGGATGTGGA TGGTGATGGCCAGATCAACTATGAGGAGTTTGTCAAAGTCATGATGGCCA AGTAAGGAGCAGTCAACCATAACTAGAAGTTAAAAAAACATAAGAAGAGA GAAGGAACGGGGCAGATAAGTTTGATGAGAAAAATACTATTTCCCTTAGG ACATCTTCATTTGGTGATATTAGCTTTGGTTGGATTGTCTGTTGGCTTGT TTGCATTATTTTGTTGCACTTTCCATTACTATTTGCTCTGTTTCTTGTTA GTAGCTTGGCTTGTTAGTTTCTTTCTTTTATTGTTTGTTATTTTATATCT ACCTTTGGATTATGAACCTAGAACAATCTGGATGGATAATCATGTTTTGC TTATGCATGACTAATTTTGTTAATATTCTAAAGTTTAGGCACTTCTATTT TTAT
back to top