Manes.01G007400.1.v6.1.five_prime_UTR.1 (five_prime_UTR)

Overview
NameManes.01G007400.1.v6.1.five_prime_UTR.1
Unique NameManes.01G007400.1.v6.1.five_prime_UTR.1
Typefive_prime_UTR
OrganismManihot esculenta (Cassava)
Sequence length1479
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chromosome01chromosomeChromosome01:1226097..1227575 -
Analyses
This five_prime_UTR is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Manihot esculenta (JGI)2015-07-22
Properties
Property NameValue
Pacid32359638
Relationships

This five_prime_UTR is a part of the following mRNA feature(s):

Feature NameUnique NameSpeciesType
Manes.01G007400.1Manes.01G007400.1.v6.1Manihot esculentamRNA


Sequences
The following sequences are available for this feature:

five_prime_UTR sequence

>Manes.01G007400.1.v6.1.five_prime_UTR.1 ID=Manes.01G007400.1.v6.1.five_prime_UTR.1|Name=Manes.01G007400.1.v6.1.five_prime_UTR.1|organism=Manihot esculenta|type=five_prime_UTR|length=1479bp
CTTCGGCTTCCTGATTATTCTCAAACAGTATTAAACTACAACAATTAATC
AAAGCAAGAAAAGATAGCAGGTGCTTGTAGCTCCCATAAATCGAGGACAT
GCAGTACAGAAATAAGAAATTGCGATCCTGAAGCAAGTAACGCCTTCAAT
TAGGAACCATAAATTGTAAGGTTTTATCTTGTTAGAGACGAGCAAATTAA
CCCAGCAATCAATACATGTAGTAATCAAAGAGCCAAAATGGCAGCTAACG
GGTGCTTATTGCGCACTTTTGAGGTCCAGGAATCAAAGAGTCAAAATCAA
CCAAATCCAAGAGTAAAAAAACCAAGAAATGAGATAATCCACAAATCAGA
GACGATCTTGGTTCCAAAGACAGTAAATATCTGACCTTTCCTTAGTTTTC
TGCTTTTGGGTCTTTACCTGAGGCTGTCTATCCGTTATTGATGTTTGTCA
ACCAAGGAGGAAAGAAAATCCAGCTCTGGTCATTTTAGGGTTCGAGATCC
AGGCCAGATTTATGGTCACCCCCTCTAGCTACCTCAACACTTCATCTTCT
ACACCAACCCTAAAGAACCCCTAAAATTTTCAATTGAAGACTCATTAAAT
CTTCCACAAGTAAAGGTAATAGTTTTTCGATCAAAAAGAAAATTCTTGCA
GCAATCAGAAAGTTTGATGCTTTCTGCAGCCAAGCAGACAAGGAATACTA
AACAATACCATAACATCCATCCACGGCCGTTGCAGTAGCTCACATACCTT
GACTTGGCCCTAGAATAAGATTACTCGTGGCTTATTTCAACAGGAAAATG
TACCGGTAACCTGTAAATTCCGGTTGCACAACCCCTCCAACACTTTCTTT
TTTTTTGTAACAAATCAATATAACTAGAGAGCTTCAATGCACGAGACCAT
CGAATCCTCCTCCGTTCGAAATTGGATAAGAACAATGACAATTTTAGTTG
TTGGACTAGGTTAATTCTGAGATTCCTTCTCCTCCTCCTATCCAATTCAC
CGTTTCACTTCAATTTGATTTTGTTCAATATCCTTCCACTCCATTGATGT
ACTGCTTTTTATTCAAACCCATTTCGCAATTGATCCCAGATATCCACCTA
AATTGAGGTTTGAGTTATTGATTTTCCGGCGAAACCAGGTTGAGTGGAGA
CAGAACTGTTCGGTAACGATGTTCAGTAGAGTTTTGGTTTAGGTCTCAGA
GTCACCTTCCGCTATCAACTACTAAGCAAGGAAAATACGGAGTACGAAGA
AGAAGAAGAAGAAGAAGAAGAGAGCCGAGCTTAAAAAATGAAAATGGGTT
GCGGCATGGGGGGATATTACGAAATTACCACCACGGAGACTGCCGGTTCC
TCTGCGGAAACAGTTGGCACGCGTCAGGCTATTAGGGGCTTTGTTGATAA
TTCCGCTGCAAGAGAGAGAACTTATTGGTTCAGTTCTAGGTTTGGAAAGA
GATGTTCTAACAAGTCAAGTCTAATAAAG
back to top